Incidental Mutation 'R6909:Olfr827'
ID538935
Institutional Source Beutler Lab
Gene Symbol Olfr827
Ensembl Gene ENSMUSG00000045559
Gene Nameolfactory receptor 827
SynonymsMOR210-5, GA_x6K02T2PULF-11878777-11877809
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130203049-130214403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130210753 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 126 (I126L)
Ref Sequence ENSEMBL: ENSMUSP00000149200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058123] [ENSMUST00000213568]
Predicted Effect probably benign
Transcript: ENSMUST00000058123
AA Change: I126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089609
Gene: ENSMUSG00000045559
AA Change: I126L

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 6e-53 PFAM
Pfam:7tm_1 53 300 2.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213568
AA Change: I126L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Olfr827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Olfr827 APN 10 130210734 missense probably damaging 1.00
IGL02358:Olfr827 APN 10 130210734 missense probably damaging 1.00
R0179:Olfr827 UTSW 10 130210338 missense probably damaging 1.00
R0401:Olfr827 UTSW 10 130210620 missense probably damaging 1.00
R0607:Olfr827 UTSW 10 130211070 missense probably benign 0.33
R1139:Olfr827 UTSW 10 130211079 missense possibly damaging 0.53
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1645:Olfr827 UTSW 10 130210212 missense probably damaging 0.99
R4712:Olfr827 UTSW 10 130210422 missense possibly damaging 0.78
R4966:Olfr827 UTSW 10 130210437 missense probably benign 0.31
R5219:Olfr827 UTSW 10 130210924 missense possibly damaging 0.84
R6363:Olfr827 UTSW 10 130211037 missense possibly damaging 0.93
R6734:Olfr827 UTSW 10 130210257 missense probably benign 0.31
R7180:Olfr827 UTSW 10 130210942 missense probably benign 0.05
R7549:Olfr827 UTSW 10 130210984 missense probably benign 0.01
R7665:Olfr827 UTSW 10 130211261 splice site probably null
R8001:Olfr827 UTSW 10 130210860 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGATCAATGACCCTAGAGGC -3'
(R):5'- GCATGATTGGCATCATAGTGACTG -3'

Sequencing Primer
(F):5'- TGACCCTAGAGGCACAAAAAG -3'
(R):5'- TGGCATCATAGTGACTGATCCCAG -3'
Posted On2018-11-06