Incidental Mutation 'R6909:Gsdma2'
ID538938
Institutional Source Beutler Lab
Gene Symbol Gsdma2
Ensembl Gene ENSMUSG00000017211
Gene Namegasdermin A2
Synonyms2210411P14Rik, 2210006M16Rik, 2200001G21Rik, 2210009F20Rik, Gsdm2, Gsdml2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98646759-98657964 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 98652557 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 224 (C224*)
Ref Sequence ENSEMBL: ENSMUSP00000091470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017355] [ENSMUST00000093938]
Predicted Effect probably null
Transcript: ENSMUST00000017355
AA Change: C57*
SMART Domains Protein: ENSMUSP00000017355
Gene: ENSMUSG00000017211
AA Change: C57*

DomainStartEndE-ValueType
Pfam:Gasdermin 6 251 2.9e-73 PFAM
low complexity region 259 273 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093938
AA Change: C224*
SMART Domains Protein: ENSMUSP00000091470
Gene: ENSMUSG00000017211
AA Change: C224*

DomainStartEndE-ValueType
Pfam:Gasdermin 3 418 9.5e-144 PFAM
low complexity region 426 440 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Gsdma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Gsdma2 APN 11 98650974 missense probably damaging 1.00
IGL03091:Gsdma2 APN 11 98652002 missense probably damaging 1.00
IGL03252:Gsdma2 APN 11 98649090 missense probably damaging 1.00
IGL03279:Gsdma2 APN 11 98657723 missense unknown
R0116:Gsdma2 UTSW 11 98649183 missense probably damaging 1.00
R0443:Gsdma2 UTSW 11 98657688 missense probably damaging 1.00
R0521:Gsdma2 UTSW 11 98654901 nonsense probably null
R0626:Gsdma2 UTSW 11 98651984 missense probably damaging 0.96
R1163:Gsdma2 UTSW 11 98650858 missense probably damaging 0.96
R1340:Gsdma2 UTSW 11 98657649 missense probably damaging 0.97
R1834:Gsdma2 UTSW 11 98649079 missense probably damaging 1.00
R1972:Gsdma2 UTSW 11 98650918 missense probably benign 0.04
R2344:Gsdma2 UTSW 11 98655591 missense probably damaging 1.00
R2964:Gsdma2 UTSW 11 98657259 missense probably damaging 1.00
R4093:Gsdma2 UTSW 11 98650851 missense probably benign 0.42
R4256:Gsdma2 UTSW 11 98651932 splice site probably null
R4711:Gsdma2 UTSW 11 98649613 missense probably damaging 0.96
R5175:Gsdma2 UTSW 11 98652612 missense probably benign 0.01
R6734:Gsdma2 UTSW 11 98649590 missense possibly damaging 0.94
R7621:Gsdma2 UTSW 11 98649549 missense probably benign
R7749:Gsdma2 UTSW 11 98657721 missense unknown
R8135:Gsdma2 UTSW 11 98652046 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACAGCAGACCTGGATTG -3'
(R):5'- TGTGTAATGGCCCCTGTCTC -3'

Sequencing Primer
(F):5'- CAGCAGACCTGGATTGGTGATTG -3'
(R):5'- GTAATGGCCCCTGTCTCTTTGTTC -3'
Posted On2018-11-06