Incidental Mutation 'R6909:Zfp72'
ID538945
Institutional Source Beutler Lab
Gene Symbol Zfp72
Ensembl Gene ENSMUSG00000069184
Gene Namezinc finger protein 72
SynonymsZfp74
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74369326-74390836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74371742 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 406 (T406A)
Ref Sequence ENSEMBL: ENSMUSP00000152502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091481
AA Change: T406A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: T406A

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223163
AA Change: T406A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Other mutations in Zfp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Zfp72 UTSW 13 74372071 missense probably damaging 1.00
R0711:Zfp72 UTSW 13 74376425 splice site probably benign
R1498:Zfp72 UTSW 13 74372617 missense probably benign 0.01
R4032:Zfp72 UTSW 13 74372330 missense possibly damaging 0.62
R4629:Zfp72 UTSW 13 74372393 missense probably damaging 1.00
R6111:Zfp72 UTSW 13 74372385 missense probably benign 0.31
R6130:Zfp72 UTSW 13 74372341 missense possibly damaging 0.75
R6277:Zfp72 UTSW 13 74372524 nonsense probably null
R6800:Zfp72 UTSW 13 74371961 missense probably benign 0.00
R7298:Zfp72 UTSW 13 74372394 missense possibly damaging 0.93
R7330:Zfp72 UTSW 13 74375034 missense probably damaging 0.99
R7341:Zfp72 UTSW 13 74372348 missense possibly damaging 0.68
RF014:Zfp72 UTSW 13 74375054 missense probably benign 0.17
Z1177:Zfp72 UTSW 13 74371792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGCTCATTGATTATGGCATG -3'
(R):5'- TTCATACTGGAGAGAAACCCTAC -3'

Sequencing Primer
(F):5'- TATGGCATGAATAAAGGATCTGACAC -3'
(R):5'- CCCTACAAGTGTGAAAAATGTAGC -3'
Posted On2018-11-06