Incidental Mutation 'R6909:Ptpn2'
ID538958
Institutional Source Beutler Lab
Gene Symbol Ptpn2
Ensembl Gene ENSMUSG00000024539
Gene Nameprotein tyrosine phosphatase, non-receptor type 2
SynonymsPtpt, TC-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6909 (G1)
Quality Score199.009
Status Not validated
Chromosome18
Chromosomal Location67665511-67724595 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 67675971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025420] [ENSMUST00000120934] [ENSMUST00000122412]
Predicted Effect probably null
Transcript: ENSMUST00000025420
SMART Domains Protein: ENSMUSP00000025420
Gene: ENSMUSG00000024539

DomainStartEndE-ValueType
PTPc 17 277 2.56e-115 SMART
Blast:PTPc 287 376 7e-38 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120934
SMART Domains Protein: ENSMUSP00000113182
Gene: ENSMUSG00000024539

DomainStartEndE-ValueType
PTPc 17 277 2.56e-115 SMART
Blast:PTPc 284 357 2e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122412
SMART Domains Protein: ENSMUSP00000112675
Gene: ENSMUSG00000024539

DomainStartEndE-ValueType
PTPc 17 277 2.56e-115 SMART
Blast:PTPc 287 399 9e-56 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. Multiple alternatively spliced transcript variants encoding different isoforms have been found. Two highly related but distinctly processed pseudogenes that localize to chromosomes 1 and 13, respectively, have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced life span, abnormalities of the hematopoietic system and an increased succeptibility to inflammatory disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Ptpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ptpn2 APN 18 67675792 missense possibly damaging 0.69
IGL01538:Ptpn2 APN 18 67681553 missense probably benign 0.00
IGL02999:Ptpn2 APN 18 67681510 missense probably damaging 0.99
R2075:Ptpn2 UTSW 18 67681475 missense probably damaging 0.97
R2273:Ptpn2 UTSW 18 67677802 missense probably damaging 0.99
R2391:Ptpn2 UTSW 18 67675889 splice site probably null
R7251:Ptpn2 UTSW 18 67675792 missense possibly damaging 0.69
R7979:Ptpn2 UTSW 18 67681571 missense possibly damaging 0.94
R8418:Ptpn2 UTSW 18 67681522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACATACCTCTCACTGC -3'
(R):5'- AACAGTATATCCTTCCCTGCATCG -3'

Sequencing Primer
(F):5'- ACAGTATCCTGCACCTTAGAAGG -3'
(R):5'- CCATCCGTAATGAGATCTGATGGC -3'
Posted On2018-11-06