Incidental Mutation 'R6909:Skor2'
ID538959
Institutional Source Beutler Lab
Gene Symbol Skor2
Ensembl Gene ENSMUSG00000091519
Gene NameSKI family transcriptional corepressor 2
SynonymsGm7348, Fussel18, Corl2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6909 (G1)
Quality Score135.008
Status Not validated
Chromosome18
Chromosomal Location76856405-76900342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76860557 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 658 (H658R)
Ref Sequence ENSEMBL: ENSMUSP00000132338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166956
AA Change: H658R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132338
Gene: ENSMUSG00000091519
AA Change: H658R

DomainStartEndE-ValueType
Pfam:Ski_Sno 25 132 2.3e-41 PFAM
c-SKI_SMAD_bind 144 236 6.92e-55 SMART
low complexity region 261 305 N/A INTRINSIC
low complexity region 320 373 N/A INTRINSIC
low complexity region 426 452 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
low complexity region 645 680 N/A INTRINSIC
low complexity region 688 707 N/A INTRINSIC
low complexity region 722 741 N/A INTRINSIC
low complexity region 747 766 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal and postnatal lethality, abnormal cerebellum development, and abnormal Purkinje cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Skor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Skor2 APN 18 76858667 missense unknown
IGL01604:Skor2 APN 18 76859951 missense possibly damaging 0.93
IGL02306:Skor2 APN 18 76862679 missense probably benign 0.01
IGL03287:Skor2 APN 18 76876135 missense probably damaging 0.99
R0225:Skor2 UTSW 18 76859098 missense unknown
R0265:Skor2 UTSW 18 76876598 missense probably damaging 0.99
R0650:Skor2 UTSW 18 76876560 missense probably benign 0.32
R1086:Skor2 UTSW 18 76859299 missense unknown
R1237:Skor2 UTSW 18 76876132 nonsense probably null
R1465:Skor2 UTSW 18 76876645 splice site probably benign
R1625:Skor2 UTSW 18 76858804 missense unknown
R1682:Skor2 UTSW 18 76859516 missense unknown
R1918:Skor2 UTSW 18 76859356 missense unknown
R2878:Skor2 UTSW 18 76860724 nonsense probably null
R3103:Skor2 UTSW 18 76859278 nonsense probably null
R3611:Skor2 UTSW 18 76858838 missense unknown
R3882:Skor2 UTSW 18 76862689 missense probably damaging 0.97
R3891:Skor2 UTSW 18 76858655 missense unknown
R4473:Skor2 UTSW 18 76859461 missense unknown
R4720:Skor2 UTSW 18 76861183 critical splice donor site probably null
R4828:Skor2 UTSW 18 76860418 missense probably damaging 1.00
R4906:Skor2 UTSW 18 76860295 missense possibly damaging 0.73
R5074:Skor2 UTSW 18 76858954 nonsense probably null
R5486:Skor2 UTSW 18 76858700 missense unknown
R5729:Skor2 UTSW 18 76858883 missense unknown
R5886:Skor2 UTSW 18 76859429 missense unknown
R6017:Skor2 UTSW 18 76858927 missense unknown
R6514:Skor2 UTSW 18 76862694 missense probably damaging 1.00
R6565:Skor2 UTSW 18 76859912 missense possibly damaging 0.70
R7169:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7171:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7188:Skor2 UTSW 18 76859809 missense possibly damaging 0.53
R7219:Skor2 UTSW 18 76860401 missense possibly damaging 0.96
R7548:Skor2 UTSW 18 76860905 missense possibly damaging 0.82
R7722:Skor2 UTSW 18 76862644 missense probably benign 0.09
R7923:Skor2 UTSW 18 76858721 missense unknown
R8125:Skor2 UTSW 18 76859678 missense unknown
R8255:Skor2 UTSW 18 76858969 missense unknown
RF015:Skor2 UTSW 18 76860788 missense probably damaging 0.99
Z1176:Skor2 UTSW 18 76860124 missense probably benign 0.15
Z1176:Skor2 UTSW 18 76860670 missense possibly damaging 0.93
Z1176:Skor2 UTSW 18 76861161 missense probably damaging 0.99
Z1177:Skor2 UTSW 18 76876093 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAGCAAGGAGTGACGTCC -3'
(R):5'- TCAGAGCTGTCCTCACTGG -3'

Sequencing Primer
(F):5'- CAAGGAGTGACGTCCGGGAC -3'
(R):5'- AGAGCTGTCCTCACTGGGGTAG -3'
Posted On2018-11-06