Incidental Mutation 'R6910:Nms'
ID538961
Institutional Source Beutler Lab
Gene Symbol Nms
Ensembl Gene ENSMUSG00000067604
Gene Nameneuromedin S
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6910 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location38939149-38950276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38941895 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000125166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088029] [ENSMUST00000160214]
Predicted Effect probably benign
Transcript: ENSMUST00000088029
AA Change: E54G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000085346
Gene: ENSMUSG00000067604
AA Change: E54G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160214
AA Change: E54G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125166
Gene: ENSMUSG00000067604
AA Change: E54G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Nms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Nms APN 1 38946111 missense possibly damaging 0.92
IGL01959:Nms APN 1 38941925 splice site probably benign
IGL02088:Nms APN 1 38939277 utr 5 prime probably benign
IGL02810:Nms APN 1 38948644 missense possibly damaging 0.94
IGL03001:Nms APN 1 38941912 missense probably benign 0.12
alacrity UTSW 1 38941895 missense probably benign 0.04
R1087:Nms UTSW 1 38944111 critical splice donor site probably null
R3689:Nms UTSW 1 38946994 splice site probably benign
R4426:Nms UTSW 1 38939296 missense probably benign
R7258:Nms UTSW 1 38946970 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACACCCTGAGAGCCAAATTG -3'
(R):5'- GAACTGTTATGCCATAATGCACC -3'

Sequencing Primer
(F):5'- CCCTGAGAGCCAAATTGAAATATTGC -3'
(R):5'- ATGCCATAATGCACCAATCTATG -3'
Posted On2018-11-06