Mutagenetix > Incidental Mutation

Incidental Mutation 'R6910:Hdac4'

538962

Institutional Source

Beutler Lab

Gene Symbol

Hdac4

Ensembl Gene

ENSMUSG00000026313

Gene Name

histone deacetylase 4

Synonyms

4932408F19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6910 (G1)

Quality Score

207.009

Status

Validated

Chromosome

Chromosomal Location

91928779-92195699 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 91982153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 463 (T463K)

Ref Sequence

ENSEMBL: ENSMUSP00000095249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644]

AlphaFold

Q6NZM9

Predicted Effect

probably damaging
Transcript: ENSMUST00000008995
AA Change: T463K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313
AA Change: T463K

Domain	Start	End	E-Value	Type
Pfam:HDAC4_Gln	61	151	5e-38	PFAM
low complexity region	289	310	N/A	INTRINSIC
low complexity region	354	368	N/A	INTRINSIC
low complexity region	472	502	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
Pfam:Hist_deacetyl	661	985	1.4e-85	PFAM
low complexity region	1066	1075	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097644
AA Change: T463K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Hdac4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Hdac4	APN	1	91959415	missense	probably damaging	0.99
IGL01396:Hdac4	APN	1	91959474	splice site	probably benign
IGL01536:Hdac4	APN	1	91930146	utr 3 prime	probably benign
IGL01860:Hdac4	APN	1	91933695	missense	probably benign	0.31
IGL02110:Hdac4	APN	1	91984405	missense	probably benign	0.00
IGL02201:Hdac4	APN	1	91987660	splice site	probably null
IGL02294:Hdac4	APN	1	91982207	missense	probably benign
IGL02367:Hdac4	APN	1	91958449	splice site	probably benign
IGL02429:Hdac4	APN	1	92012695	missense	probably benign	0.00
IGL02966:Hdac4	APN	1	92054945	missense	possibly damaging	0.94
IGL03250:Hdac4	APN	1	91934600	critical splice donor site	probably null
R0067:Hdac4	UTSW	1	92029984	missense	probably damaging	1.00
R0103:Hdac4	UTSW	1	91975644	missense	possibly damaging	0.73
R0288:Hdac4	UTSW	1	91971006	missense	probably damaging	1.00
R0334:Hdac4	UTSW	1	91956038	splice site	probably benign
R1473:Hdac4	UTSW	1	92029968	missense	possibly damaging	0.88
R1732:Hdac4	UTSW	1	91947535	missense	probably benign	0.01
R1826:Hdac4	UTSW	1	91984699	missense	probably damaging	1.00
R1987:Hdac4	UTSW	1	91934645	missense	probably damaging	1.00
R2189:Hdac4	UTSW	1	91975522	missense	probably null	0.00
R2384:Hdac4	UTSW	1	91984485	missense	probably benign	0.02
R3705:Hdac4	UTSW	1	91934694	splice site	probably benign
R3894:Hdac4	UTSW	1	91970968	missense	possibly damaging	0.95
R4440:Hdac4	UTSW	1	91945995	missense	probably damaging	1.00
R5075:Hdac4	UTSW	1	91996120	missense	probably benign	0.00
R5431:Hdac4	UTSW	1	91972790	nonsense	probably null
R5505:Hdac4	UTSW	1	91975465	missense	probably benign
R5854:Hdac4	UTSW	1	91959421	missense	probably damaging	1.00
R6018:Hdac4	UTSW	1	91958398	missense	probably damaging	1.00
R6164:Hdac4	UTSW	1	92030154	missense	probably benign	0.04
R6239:Hdac4	UTSW	1	92054972	missense	probably benign	0.17
R6247:Hdac4	UTSW	1	92012838	splice site	probably null
R6306:Hdac4	UTSW	1	91996174	missense	probably benign	0.00
R6381:Hdac4	UTSW	1	91984525	missense	possibly damaging	0.67
R6450:Hdac4	UTSW	1	91984711	missense	possibly damaging	0.81
R6504:Hdac4	UTSW	1	91968455	missense	possibly damaging	0.88
R6639:Hdac4	UTSW	1	91970948	missense	probably damaging	1.00
R6799:Hdac4	UTSW	1	92002213	missense	probably damaging	0.98
R7002:Hdac4	UTSW	1	91968361	missense	possibly damaging	0.85
R7781:Hdac4	UTSW	1	91975665	missense	probably benign	0.41
R7966:Hdac4	UTSW	1	91933680	missense	possibly damaging	0.71
R8156:Hdac4	UTSW	1	91958416	missense	probably damaging	0.99
R8732:Hdac4	UTSW	1	91947517	missense	probably damaging	1.00
R8957:Hdac4	UTSW	1	91946035	critical splice acceptor site	probably null
R9129:Hdac4	UTSW	1	91982207	missense	probably benign
R9167:Hdac4	UTSW	1	91947534	missense	probably benign	0.35
R9243:Hdac4	UTSW	1	91972789	missense	probably damaging	0.98
R9243:Hdac4	UTSW	1	91972790	missense	probably benign	0.14
R9255:Hdac4	UTSW	1	91961451	critical splice donor site	probably null
R9503:Hdac4	UTSW	1	92002234	missense	probably damaging	0.96
R9600:Hdac4	UTSW	1	91961555	missense	probably damaging	0.99
Z1177:Hdac4	UTSW	1	91956047	missense	probably damaging	1.00
Z1177:Hdac4	UTSW	1	91987611	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGAGGAAGGCTCCACACAAC -3'
(R):5'- CTCCACTGGTTACTCAACAGC -3'

Sequencing Primer
(F):5'- TGCACCAGAGTGTGTGCTC -3'
(R):5'- ACTGGTATCTTTCAGGCC -3'

Posted On

2018-11-06