Incidental Mutation 'R6910:Gm10130'
ID538965
Institutional Source Beutler Lab
Gene Symbol Gm10130
Ensembl Gene ENSMUSG00000095315
Gene Namepredicted gene 10130
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6910 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150323702-150363071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150324067 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 56 (Q56L)
Ref Sequence ENSEMBL: ENSMUSP00000117028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051153] [ENSMUST00000133235]
Predicted Effect probably benign
Transcript: ENSMUST00000051153
SMART Domains Protein: ENSMUSP00000055454
Gene: ENSMUSG00000063364

DomainStartEndE-ValueType
KRAB 22 84 4.09e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133235
AA Change: Q56L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117028
Gene: ENSMUSG00000095315
AA Change: Q56L

DomainStartEndE-ValueType
KRAB 3 66 4.56e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Gm10130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Gm10130 APN 2 150323714 missense probably damaging 1.00
R0041:Gm10130 UTSW 2 150323825 missense possibly damaging 0.78
R0109:Gm10130 UTSW 2 150323841 splice site probably benign
R5402:Gm10130 UTSW 2 150362966 missense probably benign 0.03
R5582:Gm10130 UTSW 2 150363052 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGGCTTTGCTGGATCCT -3'
(R):5'- TTCTATAGCGTAACTATTGGGCTG -3'

Sequencing Primer
(F):5'- GAATCTCGCTGCTATCGGTAAGAC -3'
(R):5'- TGCCTTGCAGACACAAATTAG -3'
Posted On2018-11-06