Incidental Mutation 'R6910:Rsrc1'
ID 538966
Institutional Source Beutler Lab
Gene Symbol Rsrc1
Ensembl Gene ENSMUSG00000034544
Gene Name arginine/serine-rich coiled-coil 1
Synonyms 1200013F24Rik, SRrp53
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 66981390-67358396 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66994649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000125547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000160504] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162362] [ENSMUST00000162693]
AlphaFold Q9DBU6
Predicted Effect unknown
Transcript: ENSMUST00000046542
AA Change: P44L
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065047
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065074
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160504
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124925
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161726
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162036
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162362
AA Change: P44L
SMART Domains Protein: ENSMUSP00000123699
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162620
Predicted Effect unknown
Transcript: ENSMUST00000162693
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182708
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine and arginine rich-related protein family. The encoded protein is involved in both constitutive and alternative mRNA splicing. This gene may be associated with schizophrenia. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Rsrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Rsrc1 APN 3 67082600 intron probably benign
IGL03180:Rsrc1 APN 3 67082543 intron probably benign
R0200:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R0463:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R1175:Rsrc1 UTSW 3 67356218 splice site probably benign
R1293:Rsrc1 UTSW 3 67356279 missense probably damaging 1.00
R1677:Rsrc1 UTSW 3 67355475 missense probably damaging 0.97
R1981:Rsrc1 UTSW 3 67350005 missense probably benign 0.18
R2039:Rsrc1 UTSW 3 66994618 missense unknown
R4222:Rsrc1 UTSW 3 66994567 missense unknown
R4624:Rsrc1 UTSW 3 67349978 missense probably damaging 1.00
R4852:Rsrc1 UTSW 3 67355602 missense probably damaging 1.00
R6102:Rsrc1 UTSW 3 66994649 missense unknown
R6103:Rsrc1 UTSW 3 66994649 missense unknown
R6104:Rsrc1 UTSW 3 66994649 missense unknown
R6127:Rsrc1 UTSW 3 66994649 missense unknown
R6129:Rsrc1 UTSW 3 66994649 missense unknown
R6153:Rsrc1 UTSW 3 67355562 missense probably benign 0.33
R6409:Rsrc1 UTSW 3 66994649 missense unknown
R6410:Rsrc1 UTSW 3 66994649 missense unknown
R6411:Rsrc1 UTSW 3 66994649 missense unknown
R6412:Rsrc1 UTSW 3 66994649 missense unknown
R6422:Rsrc1 UTSW 3 66994649 missense unknown
R6424:Rsrc1 UTSW 3 66994649 missense unknown
R6442:Rsrc1 UTSW 3 66994649 missense unknown
R6487:Rsrc1 UTSW 3 66994649 missense unknown
R6899:Rsrc1 UTSW 3 66994649 missense unknown
R6911:Rsrc1 UTSW 3 66994649 missense unknown
R6912:Rsrc1 UTSW 3 66994649 missense unknown
R6916:Rsrc1 UTSW 3 66994649 missense unknown
R6917:Rsrc1 UTSW 3 66994649 missense unknown
R6930:Rsrc1 UTSW 3 66994649 missense unknown
R6931:Rsrc1 UTSW 3 66994649 missense unknown
R6994:Rsrc1 UTSW 3 66994649 missense unknown
R6995:Rsrc1 UTSW 3 66994649 missense unknown
R6997:Rsrc1 UTSW 3 66994649 missense unknown
R7010:Rsrc1 UTSW 3 66994649 missense unknown
R7015:Rsrc1 UTSW 3 66994649 missense unknown
R7048:Rsrc1 UTSW 3 67180831 missense probably damaging 0.99
R7078:Rsrc1 UTSW 3 66994654 missense unknown
R9301:Rsrc1 UTSW 3 67290347 missense probably damaging 1.00
Z1176:Rsrc1 UTSW 3 67349982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCAAGCACATGTTAGTT -3'
(R):5'- CTTTTGGGAGAAAGGTTGCAAAG -3'

Sequencing Primer
(F):5'- GTTGGATCCAGGAGTTTACAGTCAAC -3'
(R):5'- TTGCAAAGGTAGAGGACAGAGAC -3'
Posted On 2018-11-06