Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Ift80'

538967

Institutional Source

Beutler Lab

Gene Symbol

Ift80

Ensembl Gene

ENSMUSG00000027778

Gene Name

intraflagellar transport 80

Synonyms

4921524P20Rik, Wdr56

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68892499-69004570 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 68927735 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 458 (S458A)

Ref Sequence

ENSEMBL: ENSMUSP00000133263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]

AlphaFold

Q8K057

Predicted Effect

probably benign
Transcript: ENSMUST00000029347
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: S458A

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107812
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: S458A

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169064
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: S458A

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Meta Mutation Damage Score

0.0634

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Ift80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Ift80	APN	3	68914653	nonsense	probably null
IGL01020:Ift80	APN	3	68963679	missense	probably damaging	1.00
IGL01544:Ift80	APN	3	68990782	missense	probably benign	0.05
IGL01612:Ift80	APN	3	68963663	missense	possibly damaging	0.61
IGL01743:Ift80	APN	3	68962296	missense	probably benign	0.00
IGL02187:Ift80	APN	3	68985456	missense	probably damaging	1.00
IGL02381:Ift80	APN	3	68962320	splice site	probably null
IGL02407:Ift80	APN	3	68898536	missense	probably benign
IGL02510:Ift80	APN	3	68898543	missense	probably benign	0.07
IGL02512:Ift80	APN	3	68927725	critical splice donor site	probably null
R0091:Ift80	UTSW	3	68914675	missense	probably damaging	1.00
R0212:Ift80	UTSW	3	68940173	missense	probably benign	0.05
R0348:Ift80	UTSW	3	68935899	missense	probably benign
R0357:Ift80	UTSW	3	68914653	nonsense	probably null
R1381:Ift80	UTSW	3	68914783	missense	possibly damaging	0.78
R1419:Ift80	UTSW	3	68940198	missense	probably damaging	1.00
R1643:Ift80	UTSW	3	68916157	missense	probably benign	0.06
R1899:Ift80	UTSW	3	68918513	missense	probably benign	0.00
R1926:Ift80	UTSW	3	68916165	missense	probably damaging	1.00
R2013:Ift80	UTSW	3	68990784	missense	possibly damaging	0.62
R3894:Ift80	UTSW	3	68917999	missense	probably damaging	1.00
R4214:Ift80	UTSW	3	68990808	missense	possibly damaging	0.64
R4290:Ift80	UTSW	3	68963690	missense	probably damaging	0.96
R4303:Ift80	UTSW	3	68894174	missense	probably benign	0.15
R4361:Ift80	UTSW	3	68963649	missense	probably damaging	1.00
R4576:Ift80	UTSW	3	68950530	missense	possibly damaging	0.71
R4596:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4652:Ift80	UTSW	3	68914940	missense	probably benign	0.32
R4654:Ift80	UTSW	3	68918537	missense	possibly damaging	0.94
R4720:Ift80	UTSW	3	68962290	missense	possibly damaging	0.50
R4865:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4885:Ift80	UTSW	3	68950496	missense	probably damaging	0.98
R5357:Ift80	UTSW	3	68990780	missense	possibly damaging	0.62
R5561:Ift80	UTSW	3	68967863	missense	probably benign	0.00
R5589:Ift80	UTSW	3	68930900	missense	probably damaging	1.00
R5806:Ift80	UTSW	3	68950476	missense	probably benign	0.09
R6962:Ift80	UTSW	3	68994545	start gained	probably benign
R7157:Ift80	UTSW	3	68990944	nonsense	probably null
R7452:Ift80	UTSW	3	68994282	splice site	probably null
R7504:Ift80	UTSW	3	68918005	missense	probably damaging	0.99
R8077:Ift80	UTSW	3	68916145	missense	probably benign	0.01
R8435:Ift80	UTSW	3	68985454	missense	probably damaging	1.00
R8821:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8831:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8897:Ift80	UTSW	3	68950476	missense	probably benign
R9222:Ift80	UTSW	3	68918561	missense	possibly damaging	0.58
R9328:Ift80	UTSW	3	68940150	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAAGTCTGGGCAGCAGAC -3'
(R):5'- CTCTGTGGTCCATAAAGCTGAG -3'

Sequencing Primer
(F):5'- ACAGGCCCTATTCCAGAATTTC -3'
(R):5'- GTGGTCCATAAAGCTGAGTAATACC -3'

Posted On

2018-11-06