Incidental Mutation 'R6910:Ift80'
ID 538967
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Name intraflagellar transport 80
Synonyms 4921524P20Rik, Wdr56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 68892499-69004570 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 68927735 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 458 (S458A)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
AlphaFold Q8K057
Predicted Effect probably benign
Transcript: ENSMUST00000029347
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: S458A

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107812
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: S458A

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169064
AA Change: S458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: S458A

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68914653 nonsense probably null
IGL01020:Ift80 APN 3 68963679 missense probably damaging 1.00
IGL01544:Ift80 APN 3 68990782 missense probably benign 0.05
IGL01612:Ift80 APN 3 68963663 missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68962296 missense probably benign 0.00
IGL02187:Ift80 APN 3 68985456 missense probably damaging 1.00
IGL02381:Ift80 APN 3 68962320 splice site probably null
IGL02407:Ift80 APN 3 68898536 missense probably benign
IGL02510:Ift80 APN 3 68898543 missense probably benign 0.07
IGL02512:Ift80 APN 3 68927725 critical splice donor site probably null
R0091:Ift80 UTSW 3 68914675 missense probably damaging 1.00
R0212:Ift80 UTSW 3 68940173 missense probably benign 0.05
R0348:Ift80 UTSW 3 68935899 missense probably benign
R0357:Ift80 UTSW 3 68914653 nonsense probably null
R1381:Ift80 UTSW 3 68914783 missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68940198 missense probably damaging 1.00
R1643:Ift80 UTSW 3 68916157 missense probably benign 0.06
R1899:Ift80 UTSW 3 68918513 missense probably benign 0.00
R1926:Ift80 UTSW 3 68916165 missense probably damaging 1.00
R2013:Ift80 UTSW 3 68990784 missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68917999 missense probably damaging 1.00
R4214:Ift80 UTSW 3 68990808 missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68963690 missense probably damaging 0.96
R4303:Ift80 UTSW 3 68894174 missense probably benign 0.15
R4361:Ift80 UTSW 3 68963649 missense probably damaging 1.00
R4576:Ift80 UTSW 3 68950530 missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4652:Ift80 UTSW 3 68914940 missense probably benign 0.32
R4654:Ift80 UTSW 3 68918537 missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68962290 missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4885:Ift80 UTSW 3 68950496 missense probably damaging 0.98
R5357:Ift80 UTSW 3 68990780 missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68967863 missense probably benign 0.00
R5589:Ift80 UTSW 3 68930900 missense probably damaging 1.00
R5806:Ift80 UTSW 3 68950476 missense probably benign 0.09
R6962:Ift80 UTSW 3 68994545 start gained probably benign
R7157:Ift80 UTSW 3 68990944 nonsense probably null
R7452:Ift80 UTSW 3 68994282 splice site probably null
R7504:Ift80 UTSW 3 68918005 missense probably damaging 0.99
R8077:Ift80 UTSW 3 68916145 missense probably benign 0.01
R8435:Ift80 UTSW 3 68985454 missense probably damaging 1.00
R8821:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8831:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8897:Ift80 UTSW 3 68950476 missense probably benign
R9222:Ift80 UTSW 3 68918561 missense possibly damaging 0.58
R9328:Ift80 UTSW 3 68940150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAGTCTGGGCAGCAGAC -3'
(R):5'- CTCTGTGGTCCATAAAGCTGAG -3'

Sequencing Primer
(F):5'- ACAGGCCCTATTCCAGAATTTC -3'
(R):5'- GTGGTCCATAAAGCTGAGTAATACC -3'
Posted On 2018-11-06