Incidental Mutation 'R6910:Scp2'
ID 538969
Institutional Source Beutler Lab
Gene Symbol Scp2
Ensembl Gene ENSMUSG00000028603
Gene Name sterol carrier protein 2, liver
Synonyms NSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 108043839-108144998 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108105086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 81 (G81C)
Ref Sequence ENSEMBL: ENSMUSP00000123630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000130776] [ENSMUST00000149106]
AlphaFold P32020
Predicted Effect probably damaging
Transcript: ENSMUST00000030340
AA Change: G97C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: G97C

DomainStartEndE-ValueType
Pfam:Thiolase_N 14 240 9.6e-25 PFAM
Pfam:Thiolase_C 277 402 2.9e-15 PFAM
Pfam:SCP2 437 539 1.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130776
AA Change: G81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123630
Gene: ENSMUSG00000028603
AA Change: G81C

DomainStartEndE-ValueType
Pfam:Thiolase_N 9 110 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149106
SMART Domains Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603

DomainStartEndE-ValueType
SCOP:d1qfla1 14 202 2e-18 SMART
Meta Mutation Damage Score 0.9747 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Scp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Scp2 APN 4 108074442 splice site probably null
IGL02190:Scp2 APN 4 108087128 missense probably benign 0.22
IGL02615:Scp2 APN 4 108107631 missense probably benign 0.40
IGL03006:Scp2 APN 4 108091280 missense probably benign 0.00
IGL03107:Scp2 APN 4 108098115 missense probably benign 0.00
IGL03124:Scp2 APN 4 108063906 missense probably damaging 1.00
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R1507:Scp2 UTSW 4 108087012 frame shift probably null
R1861:Scp2 UTSW 4 108091321 missense probably damaging 1.00
R2151:Scp2 UTSW 4 108063944 missense probably benign
R3013:Scp2 UTSW 4 108071357 missense probably damaging 1.00
R4127:Scp2 UTSW 4 108063984 missense probably benign 0.00
R4271:Scp2 UTSW 4 108085211 missense probably damaging 1.00
R4385:Scp2 UTSW 4 108071350 missense probably damaging 1.00
R5046:Scp2 UTSW 4 108071291 missense probably benign 0.07
R5345:Scp2 UTSW 4 108055579 splice site probably null
R5401:Scp2 UTSW 4 108144779 critical splice donor site probably null
R6367:Scp2 UTSW 4 108112250 missense probably damaging 1.00
R6415:Scp2 UTSW 4 108105140 missense probably benign 0.22
R6681:Scp2 UTSW 4 108091316 missense probably damaging 1.00
R6974:Scp2 UTSW 4 108071278 start codon destroyed probably null 0.01
R7206:Scp2 UTSW 4 108074441 missense probably benign 0.00
R7342:Scp2 UTSW 4 108091321 missense probably benign 0.02
R8935:Scp2 UTSW 4 108092875 missense probably damaging 0.98
R9035:Scp2 UTSW 4 108055520 missense probably damaging 1.00
R9151:Scp2 UTSW 4 108074406 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTGGAAAGAAAGCTCAGTGGTT -3'
(R):5'- AGAGGTCGTAGCGCATCACT -3'

Sequencing Primer
(F):5'- TTCCAGAGGACCCAGGTTCAATTC -3'
(R):5'- GTAGCGCATCACTGTCCTG -3'
Posted On 2018-11-06