Incidental Mutation 'R6910:Olfr1331'
ID 538970
Institutional Source Beutler Lab
Gene Symbol Olfr1331
Ensembl Gene ENSMUSG00000073769
Gene Name olfactory receptor 1331
Synonyms MOR259-3P, GA_x6K02T2QD9B-18670866-18669913
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118864649-118871707 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118869138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 119 (M119K)
Ref Sequence ENSEMBL: ENSMUSP00000101967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094831] [ENSMUST00000106360] [ENSMUST00000216589]
AlphaFold K7N684
Predicted Effect probably damaging
Transcript: ENSMUST00000094831
AA Change: M119K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092426
Gene: ENSMUSG00000073769
AA Change: M119K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.1e-53 PFAM
Pfam:7tm_1 42 291 3.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106360
AA Change: M119K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101967
Gene: ENSMUSG00000073769
AA Change: M119K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.2e-28 PFAM
Pfam:7tm_4 139 283 2.8e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216589
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1973 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Olfr1331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr1331 APN 4 118869287 missense probably damaging 1.00
IGL01314:Olfr1331 APN 4 118869131 missense probably benign 0.26
IGL02025:Olfr1331 APN 4 118869165 missense probably damaging 1.00
IGL02458:Olfr1331 APN 4 118869300 missense possibly damaging 0.83
IGL02793:Olfr1331 APN 4 118869597 missense probably damaging 1.00
IGL02827:Olfr1331 APN 4 118868960 missense probably damaging 0.99
IGL02863:Olfr1331 APN 4 118868886 missense possibly damaging 0.52
IGL03125:Olfr1331 APN 4 118868921 missense possibly damaging 0.95
R0078:Olfr1331 UTSW 4 118869227 missense probably benign
R0152:Olfr1331 UTSW 4 118868886 missense possibly damaging 0.89
R0299:Olfr1331 UTSW 4 118869416 missense probably benign 0.00
R3881:Olfr1331 UTSW 4 118869353 missense probably benign 0.00
R3928:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R3929:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R5288:Olfr1331 UTSW 4 118869575 missense probably damaging 1.00
R5552:Olfr1331 UTSW 4 118869468 missense probably damaging 1.00
R5672:Olfr1331 UTSW 4 118869182 missense possibly damaging 0.83
R5773:Olfr1331 UTSW 4 118869521 missense probably damaging 0.97
R6117:Olfr1331 UTSW 4 118869144 missense probably benign 0.39
R6911:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6912:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R7164:Olfr1331 UTSW 4 118869725 missense probably benign 0.30
R7446:Olfr1331 UTSW 4 118868822 missense possibly damaging 0.83
R9747:Olfr1331 UTSW 4 118869020 missense probably damaging 1.00
T0975:Olfr1331 UTSW 4 118869303 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTCATCATCATGCTGGTCTG -3'
(R):5'- ACAAGTAGTGGTTGACCCTG -3'

Sequencing Primer
(F):5'- ATCATGCTGGTCTGCCTGGAC -3'
(R):5'- CCTGTTGGGCCCACAATATG -3'
Posted On 2018-11-06