Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Epha2'

538971

Institutional Source

Beutler Lab

Gene Symbol

Epha2

Ensembl Gene

ENSMUSG00000006445

Gene Name

Eph receptor A2

Synonyms

Myk2, Eck, Sek-2, Sek2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.638) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141301240-141329384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141321513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 597 (D597G)

Ref Sequence

ENSEMBL: ENSMUSP00000006614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006614]

AlphaFold

Q03145

Predicted Effect

probably damaging
Transcript: ENSMUST00000006614
AA Change: D597G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: D597G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
EPH_lbd	27	200	1.31e-112	SMART
FN3	330	420	1.16e-6	SMART
FN3	437	517	3.73e-10	SMART
Pfam:EphA2_TM	538	611	5.9e-22	PFAM
TyrKc	614	872	2.23e-135	SMART
SAM	902	969	1.5e-21	SMART

Meta Mutation Damage Score

0.8445

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Epha2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02148:Epha2	APN	4	141318524	missense	probably damaging	1.00
IGL02812:Epha2	APN	4	141318919	splice site	probably benign
IGL03377:Epha2	APN	4	141322412	missense	probably benign	0.08
R0165:Epha2	UTSW	4	141321892	critical splice donor site	probably null
R0321:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R1584:Epha2	UTSW	4	141322047	splice site	probably null
R1586:Epha2	UTSW	4	141318605	splice site	probably benign
R1695:Epha2	UTSW	4	141306517	missense	possibly damaging	0.74
R1721:Epha2	UTSW	4	141322652	missense	probably damaging	1.00
R1731:Epha2	UTSW	4	141321752	missense	possibly damaging	0.81
R1813:Epha2	UTSW	4	141308546	missense	possibly damaging	0.86
R1875:Epha2	UTSW	4	141308979	missense	probably benign	0.02
R2226:Epha2	UTSW	4	141321237	missense	probably damaging	1.00
R2314:Epha2	UTSW	4	141319014	missense	probably damaging	1.00
R2342:Epha2	UTSW	4	141323531	missense	probably benign	0.00
R3872:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R3927:Epha2	UTSW	4	141306550	missense	probably damaging	1.00
R4688:Epha2	UTSW	4	141318981	missense	probably benign
R4795:Epha2	UTSW	4	141322416	splice site	probably null
R4974:Epha2	UTSW	4	141321705	missense	probably damaging	0.99
R5055:Epha2	UTSW	4	141309069	missense	probably benign	0.09
R5123:Epha2	UTSW	4	141308865	missense	possibly damaging	0.71
R5424:Epha2	UTSW	4	141318940	nonsense	probably null
R5522:Epha2	UTSW	4	141308556	missense	probably damaging	1.00
R5657:Epha2	UTSW	4	141323494	missense	probably damaging	1.00
R5717:Epha2	UTSW	4	141322071	missense	probably benign
R5864:Epha2	UTSW	4	141308427	missense	probably damaging	0.98
R6151:Epha2	UTSW	4	141318480	critical splice acceptor site	probably null
R6244:Epha2	UTSW	4	141316912	missense	probably benign	0.00
R6288:Epha2	UTSW	4	141317033	missense	probably benign	0.01
R6696:Epha2	UTSW	4	141321539	missense	probably benign
R6817:Epha2	UTSW	4	141308994	missense	probably damaging	0.98
R6875:Epha2	UTSW	4	141328468	missense	probably damaging	1.00
R6925:Epha2	UTSW	4	141308757	missense	probably benign
R7330:Epha2	UTSW	4	141308453	missense	probably benign	0.00
R7977:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R7987:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R8081:Epha2	UTSW	4	141322294	missense	probably damaging	1.00
R9095:Epha2	UTSW	4	141316701	missense	possibly damaging	0.95
RF024:Epha2	UTSW	4	141323406	critical splice acceptor site	unknown
Z1177:Epha2	UTSW	4	141318998	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTAAGATGTACCCTCCTCAGG -3'
(R):5'- TCTCCAAACTCTCCTGCAGG -3'

Sequencing Primer
(F):5'- ACCTAGAGGCTCCATGCTG -3'
(R):5'- TCCTGCAGGCGGGCAAG -3'

Posted On

2018-11-06