Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Gcn1l1'

538973

Institutional Source

Beutler Lab

Gene Symbol

Gcn1l1

Ensembl Gene

ENSMUSG00000041638

Gene Name

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

Synonyms

GCN1L, G431004K08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115565254-115622654 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115606538 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1598 (T1598A)

Ref Sequence

ENSEMBL: ENSMUSP00000069432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454]

AlphaFold

E9PVA8

Predicted Effect

probably benign
Transcript: ENSMUST00000064454
AA Change: T1598A

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: T1598A

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Meta Mutation Damage Score

0.0752

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Gcn1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00869:Gcn1l1	APN	5	115588143	splice site	probably benign
IGL00974:Gcn1l1	APN	5	115613793	missense	possibly damaging	0.88
IGL01566:Gcn1l1	APN	5	115611058	missense	probably damaging	1.00
IGL01843:Gcn1l1	APN	5	115619700	missense	probably damaging	1.00
IGL01885:Gcn1l1	APN	5	115576115	splice site	probably null
IGL02081:Gcn1l1	APN	5	115585871	missense	probably damaging	1.00
IGL02118:Gcn1l1	APN	5	115610879	missense	probably damaging	1.00
IGL02150:Gcn1l1	APN	5	115609868	missense	probably damaging	1.00
IGL02190:Gcn1l1	APN	5	115614124	missense	probably damaging	1.00
IGL02219:Gcn1l1	APN	5	115613767	missense	possibly damaging	0.68
IGL02507:Gcn1l1	APN	5	115585881	missense	probably benign	0.11
IGL02644:Gcn1l1	APN	5	115575191	missense	probably benign
IGL02678:Gcn1l1	APN	5	115613755	missense	probably damaging	0.99
IGL02748:Gcn1l1	APN	5	115610800	splice site	probably null
IGL02755:Gcn1l1	APN	5	115604006	splice site	probably null
IGL02896:Gcn1l1	APN	5	115619648	splice site	probably benign
cusp	UTSW	5	115611060	missense	probably damaging	1.00
farthing	UTSW	5	115576108	splice site	probably benign
IGL03147:Gcn1l1	UTSW	5	115610858	missense	possibly damaging	0.78
R0362:Gcn1l1	UTSW	5	115576108	splice site	probably benign
R0540:Gcn1l1	UTSW	5	115588956	missense	probably benign	0.00
R0569:Gcn1l1	UTSW	5	115595059	missense	probably benign	0.00
R0570:Gcn1l1	UTSW	5	115592421	missense	probably damaging	1.00
R0584:Gcn1l1	UTSW	5	115595015	missense	probably damaging	1.00
R0630:Gcn1l1	UTSW	5	115581089	missense	probably benign	0.06
R0656:Gcn1l1	UTSW	5	115589303	missense	probably benign	0.27
R0801:Gcn1l1	UTSW	5	115591006	missense	probably benign	0.12
R0890:Gcn1l1	UTSW	5	115579793	missense	possibly damaging	0.77
R1400:Gcn1l1	UTSW	5	115614161	missense	probably damaging	1.00
R1485:Gcn1l1	UTSW	5	115574617	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1673:Gcn1l1	UTSW	5	115582297	missense	probably benign
R1894:Gcn1l1	UTSW	5	115589115	missense	probably damaging	1.00
R2114:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2116:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2117:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2152:Gcn1l1	UTSW	5	115609829	missense	probably benign	0.07
R2162:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R2216:Gcn1l1	UTSW	5	115593661	missense	probably benign
R2218:Gcn1l1	UTSW	5	115619661	missense	probably benign	0.04
R2278:Gcn1l1	UTSW	5	115611175	missense	probably damaging	1.00
R2280:Gcn1l1	UTSW	5	115612730	missense	probably damaging	1.00
R3719:Gcn1l1	UTSW	5	115579817	missense	probably benign	0.03
R3729:Gcn1l1	UTSW	5	115583394	splice site	probably benign
R3833:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R3932:Gcn1l1	UTSW	5	115587834	missense	probably benign	0.11
R4067:Gcn1l1	UTSW	5	115599088	missense	probably damaging	1.00
R4152:Gcn1l1	UTSW	5	115613354	critical splice acceptor site	probably null
R4179:Gcn1l1	UTSW	5	115588050	missense	probably benign	0.00
R4292:Gcn1l1	UTSW	5	115576148	missense	possibly damaging	0.49
R4350:Gcn1l1	UTSW	5	115603330	missense	probably damaging	1.00
R4493:Gcn1l1	UTSW	5	115594144	missense	probably benign
R4672:Gcn1l1	UTSW	5	115606520	missense	probably damaging	1.00
R4749:Gcn1l1	UTSW	5	115614402	missense	probably benign
R4753:Gcn1l1	UTSW	5	115616478	missense	probably benign
R4826:Gcn1l1	UTSW	5	115593693	missense	probably benign
R4873:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4875:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4932:Gcn1l1	UTSW	5	115592144	missense	probably benign	0.00
R4992:Gcn1l1	UTSW	5	115599166	missense	probably benign	0.29
R5049:Gcn1l1	UTSW	5	115606671	missense	probably damaging	1.00
R5211:Gcn1l1	UTSW	5	115619312	missense	probably benign	0.04
R5226:Gcn1l1	UTSW	5	115588067	missense	probably benign	0.01
R5338:Gcn1l1	UTSW	5	115583403	missense	probably benign	0.00
R5914:Gcn1l1	UTSW	5	115610135	synonymous	silent
R5932:Gcn1l1	UTSW	5	115592376	missense	possibly damaging	0.77
R6422:Gcn1l1	UTSW	5	115609544	missense	probably damaging	1.00
R6435:Gcn1l1	UTSW	5	115611022	critical splice acceptor site	probably null
R6607:Gcn1l1	UTSW	5	115609478	missense	probably damaging	0.98
R6724:Gcn1l1	UTSW	5	115609158	splice site	probably null
R6861:Gcn1l1	UTSW	5	115611049	missense	probably benign
R6875:Gcn1l1	UTSW	5	115588110	missense	probably damaging	1.00
R6975:Gcn1l1	UTSW	5	115613459	missense	probably damaging	1.00
R7027:Gcn1l1	UTSW	5	115616546	critical splice donor site	probably null
R7038:Gcn1l1	UTSW	5	115611144	missense	probably damaging	1.00
R7171:Gcn1l1	UTSW	5	115590293	missense	probably benign	0.02
R7276:Gcn1l1	UTSW	5	115611060	missense	probably damaging	1.00
R7456:Gcn1l1	UTSW	5	115604946	nonsense	probably null
R7473:Gcn1l1	UTSW	5	115581804	missense	probably benign	0.09
R7517:Gcn1l1	UTSW	5	115619696	missense	probably benign	0.01
R7714:Gcn1l1	UTSW	5	115595300	missense	probably damaging	0.97
R7752:Gcn1l1	UTSW	5	115615568	missense	probably damaging	1.00
R7812:Gcn1l1	UTSW	5	115593692	missense	possibly damaging	0.91
R7922:Gcn1l1	UTSW	5	115614468	missense	probably benign
R8070:Gcn1l1	UTSW	5	115588998	missense	probably benign	0.09
R8218:Gcn1l1	UTSW	5	115581529	missense	probably benign	0.00
R8329:Gcn1l1	UTSW	5	115609862	missense	probably damaging	0.99
R8413:Gcn1l1	UTSW	5	115579639	missense	probably benign	0.00
R8795:Gcn1l1	UTSW	5	115614395	missense	probably benign	0.02
R8802:Gcn1l1	UTSW	5	115609883	missense	probably damaging	1.00
R8899:Gcn1l1	UTSW	5	115579161	missense	probably benign	0.04
R8946:Gcn1l1	UTSW	5	115595345	missense	probably benign	0.02
R8963:Gcn1l1	UTSW	5	115589094	missense	probably benign	0.25
R9006:Gcn1l1	UTSW	5	115581507	missense	probably benign	0.22
R9163:Gcn1l1	UTSW	5	115604885	missense	probably benign
R9177:Gcn1l1	UTSW	5	115581808	missense	probably benign	0.35
R9187:Gcn1l1	UTSW	5	115614118	missense	probably damaging	1.00
R9411:Gcn1l1	UTSW	5	115595039	missense	possibly damaging	0.87
Z1177:Gcn1l1	UTSW	5	115614149	missense	probably damaging	0.99
Z1191:Gcn1l1	UTSW	5	115575293	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AAACTAGCCCGTTCTCAGTG -3'
(R):5'- CCTGTGAACCTAAGTGGCAAC -3'

Sequencing Primer
(F):5'- TAGCCCGTTCTCAGTGCAGAG -3'
(R):5'- ATCCCCGTCTGCTGCAAG -3'

Posted On

2018-11-06