Mutagenetix > Incidental Mutation

Incidental Mutation 'R6910:Zan'

538974

Institutional Source

Beutler Lab

Gene Symbol

Zan

Ensembl Gene

ENSMUSG00000079173

Gene Name

zonadhesin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137378637-137477064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 137419080 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 3041 (E3041G)

Ref Sequence

ENSEMBL: ENSMUSP00000132895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000117564
AA Change: E3041G

SMART Domains

Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: E3041G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MAM	42	210	3.55e-20	SMART
MAM	214	374	3.97e-9	SMART
MAM	375	542	5.7e-42	SMART
low complexity region	549	563	N/A	INTRINSIC
low complexity region	578	607	N/A	INTRINSIC
low complexity region	637	648	N/A	INTRINSIC
low complexity region	672	689	N/A	INTRINSIC
low complexity region	702	779	N/A	INTRINSIC
low complexity region	782	865	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	941	1038	N/A	INTRINSIC
low complexity region	1043	1084	N/A	INTRINSIC
low complexity region	1096	1131	N/A	INTRINSIC
low complexity region	1136	1147	N/A	INTRINSIC
low complexity region	1150	1167	N/A	INTRINSIC
low complexity region	1178	1192	N/A	INTRINSIC
EGF_like	1236	1259	7.09e1	SMART
VWC	1266	1356	5e-3	SMART
VWD	1316	1477	3.73e-36	SMART
C8	1521	1596	6.91e-23	SMART
EGF_like	1607	1647	6.41e1	SMART
VWC	1654	1745	1.08e-2	SMART
VWD	1703	1869	2.71e-47	SMART
C8	1908	1982	3.45e-32	SMART
Pfam:TIL	1985	2039	4.5e-13	PFAM
VWC	2041	2095	4.84e-1	SMART
FOLN	2074	2096	9.79e1	SMART
VWD	2088	2260	5.49e-25	SMART
C8	2307	2381	6.73e-3	SMART
Pfam:TIL	2384	2442	3e-12	PFAM
VWC	2444	2504	1.13e-1	SMART
FOLN	2475	2498	3.73e0	SMART
EGF_like	2512	2557	6.54e1	SMART
VWC	2564	2637	3.68e-2	SMART
FOLN	2595	2618	4.04e0	SMART
VWC	2684	2744	3.08e-1	SMART
FOLN	2715	2738	7.78e0	SMART
VWC	2804	2864	1.7e0	SMART
FOLN	2835	2858	2.58e1	SMART
VWC	2924	2984	4.74e-1	SMART
VWC	3044	3104	2.44e-1	SMART
VWC	3164	3237	7.57e-2	SMART
FOLN	3195	3218	2.25e1	SMART
VWC	3284	3344	4.22e-1	SMART
FOLN	3315	3338	2.1e0	SMART
VWC	3401	3461	7.67e-2	SMART
FOLN	3432	3455	4.39e0	SMART
VWC	3521	3581	8.45e-2	SMART
FOLN	3552	3575	1.27e1	SMART
VWC	3641	3714	3.51e-1	SMART
FOLN	3672	3695	2.16e0	SMART
VWC	3761	3821	9.7e-2	SMART
FOLN	3792	3815	1.27e1	SMART
VWC	3881	3954	1.83e-1	SMART
FOLN	3912	3933	1.17e1	SMART
VWC	3997	4050	3.61e-1	SMART
FOLN	4028	4051	1.84e0	SMART
EGF_like	4081	4126	5.79e1	SMART
VWC	4133	4210	4.03e-1	SMART
FOLN	4164	4187	7.99e0	SMART
VWC	4253	4308	3.21e-1	SMART
FOLN	4284	4302	8.54e1	SMART
VWC	4368	4428	2.74e-2	SMART
FOLN	4399	4422	7.46e1	SMART
VWC	4488	4548	6.37e-1	SMART
FOLN	4519	4542	1.04e0	SMART
VWC	4608	4681	4.47e-1	SMART
FOLN	4639	4662	2.22e0	SMART
VWC	4728	4781	1.12e0	SMART
FOLN	4759	4782	3.29e1	SMART
EGF	4800	4841	2.43e1	SMART
VWC	4848	4901	7.59e-1	SMART
FOLN	4879	4902	5.31e0	SMART
VWD	4899	5061	4.49e-30	SMART
low complexity region	5086	5102	N/A	INTRINSIC
C8	5113	5191	8.25e-21	SMART
Pfam:TIL	5194	5247	1.9e-12	PFAM
VWC	5249	5307	1.22e0	SMART
EGF	5306	5339	3.15e-3	SMART
transmembrane domain	5356	5378	N/A	INTRINSIC
low complexity region	5381	5399	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000164178
AA Change: E3041G

SMART Domains

Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: E3041G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MAM	42	210	3.55e-20	SMART
MAM	214	374	3.97e-9	SMART
MAM	375	542	5.7e-42	SMART
low complexity region	549	563	N/A	INTRINSIC
low complexity region	578	607	N/A	INTRINSIC
low complexity region	637	648	N/A	INTRINSIC
low complexity region	672	689	N/A	INTRINSIC
low complexity region	702	779	N/A	INTRINSIC
low complexity region	782	865	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	941	1038	N/A	INTRINSIC
low complexity region	1043	1084	N/A	INTRINSIC
low complexity region	1096	1131	N/A	INTRINSIC
low complexity region	1136	1147	N/A	INTRINSIC
low complexity region	1150	1167	N/A	INTRINSIC
low complexity region	1178	1192	N/A	INTRINSIC
EGF_like	1236	1259	7.09e1	SMART
VWC	1266	1356	5e-3	SMART
VWD	1316	1477	3.73e-36	SMART
C8	1521	1596	6.91e-23	SMART
EGF_like	1607	1647	6.41e1	SMART
VWC	1654	1745	1.08e-2	SMART
VWD	1703	1869	2.71e-47	SMART
C8	1908	1982	3.45e-32	SMART
Pfam:TIL	1985	2039	2.3e-13	PFAM
VWC	2041	2095	4.84e-1	SMART
FOLN	2074	2096	9.79e1	SMART
VWD	2088	2260	5.49e-25	SMART
C8	2307	2381	6.73e-3	SMART
Pfam:TIL	2384	2442	6e-12	PFAM
VWC	2444	2504	1.13e-1	SMART
FOLN	2475	2498	3.73e0	SMART
EGF_like	2512	2557	6.54e1	SMART
VWC	2564	2637	3.68e-2	SMART
FOLN	2595	2618	4.04e0	SMART
VWC	2684	2744	3.08e-1	SMART
FOLN	2715	2738	7.78e0	SMART
VWC	2804	2864	1.7e0	SMART
FOLN	2835	2858	2.58e1	SMART
VWC	2924	2984	4.74e-1	SMART
VWC	3044	3104	2.44e-1	SMART
VWC	3164	3237	7.57e-2	SMART
FOLN	3195	3218	2.25e1	SMART
VWC	3284	3344	4.22e-1	SMART
FOLN	3315	3338	2.1e0	SMART
VWC	3401	3461	7.67e-2	SMART
FOLN	3432	3455	4.39e0	SMART
VWC	3521	3581	8.45e-2	SMART
FOLN	3552	3575	1.27e1	SMART
VWC	3641	3714	3.51e-1	SMART
FOLN	3672	3695	2.16e0	SMART
VWC	3761	3821	9.7e-2	SMART
FOLN	3792	3815	1.27e1	SMART
VWC	3881	3954	1.83e-1	SMART
FOLN	3912	3933	1.17e1	SMART
VWC	3997	4050	3.61e-1	SMART
FOLN	4028	4051	1.84e0	SMART
EGF_like	4081	4126	5.79e1	SMART
VWC	4133	4210	4.03e-1	SMART
FOLN	4164	4187	7.99e0	SMART
VWC	4253	4308	3.21e-1	SMART
FOLN	4284	4302	8.54e1	SMART
VWC	4368	4428	2.74e-2	SMART
FOLN	4399	4422	7.46e1	SMART
VWC	4488	4548	6.37e-1	SMART
FOLN	4519	4542	1.04e0	SMART
VWC	4608	4681	4.47e-1	SMART
FOLN	4639	4662	2.22e0	SMART
VWC	4728	4781	1.12e0	SMART
FOLN	4759	4782	3.29e1	SMART
EGF	4800	4841	2.43e1	SMART
VWC	4848	4901	7.59e-1	SMART
FOLN	4879	4902	5.31e0	SMART
VWD	4899	5061	4.49e-30	SMART
low complexity region	5086	5102	N/A	INTRINSIC
C8	5113	5191	8.25e-21	SMART
Pfam:TIL	5194	5247	7.2e-13	PFAM
VWC	5249	5307	1.22e0	SMART
EGF	5306	5339	3.15e-3	SMART
transmembrane domain	5356	5378	N/A	INTRINSIC
low complexity region	5381	5399	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Zan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Zan	APN	5	137387820	critical splice donor site	probably null
IGL00158:Zan	APN	5	137454257	missense	unknown
IGL00473:Zan	APN	5	137464250	missense	possibly damaging	0.68
IGL00536:Zan	APN	5	137446682	missense	unknown
IGL00567:Zan	APN	5	137416277	unclassified	probably benign
IGL00820:Zan	APN	5	137386364	missense	unknown
IGL00850:Zan	APN	5	137464113	missense	unknown
IGL00906:Zan	APN	5	137389360	missense	unknown
IGL00920:Zan	APN	5	137464524	missense	unknown
IGL00964:Zan	APN	5	137405941	unclassified	probably benign
IGL01356:Zan	APN	5	137436432	missense	unknown
IGL01361:Zan	APN	5	137414342	unclassified	probably benign
IGL01362:Zan	APN	5	137452450	missense	unknown
IGL01411:Zan	APN	5	137388893	missense	unknown
IGL01412:Zan	APN	5	137393032	missense	unknown
IGL01531:Zan	APN	5	137424612	missense	unknown
IGL01561:Zan	APN	5	137463866	missense	unknown
IGL01564:Zan	APN	5	137446733	missense	unknown
IGL01568:Zan	APN	5	137464844	missense	unknown
IGL01719:Zan	APN	5	137395654	missense	unknown
IGL01732:Zan	APN	5	137393011	missense	unknown
IGL01761:Zan	APN	5	137425597	missense	unknown
IGL01771:Zan	APN	5	137393068	missense	unknown
IGL01810:Zan	APN	5	137463626	missense	unknown
IGL01845:Zan	APN	5	137380854	unclassified	probably benign
IGL01885:Zan	APN	5	137464124	missense	unknown
IGL01992:Zan	APN	5	137424106	missense	unknown
IGL02026:Zan	APN	5	137405464	unclassified	probably benign
IGL02065:Zan	APN	5	137386960	nonsense	probably null
IGL02133:Zan	APN	5	137411498	missense	possibly damaging	0.84
IGL02274:Zan	APN	5	137421167	missense	unknown
IGL02449:Zan	APN	5	137389327	missense	unknown
IGL02456:Zan	APN	5	137446844	missense	unknown
IGL02493:Zan	APN	5	137435706	missense	unknown
IGL02496:Zan	APN	5	137464794	nonsense	probably null
IGL02528:Zan	APN	5	137465141	missense	possibly damaging	0.83
IGL02550:Zan	APN	5	137387039	missense	unknown
IGL02598:Zan	APN	5	137446211	missense	unknown
IGL02697:Zan	APN	5	137400548	missense	unknown
IGL02933:Zan	APN	5	137428414	missense	unknown
IGL02963:Zan	APN	5	137456250	missense	unknown
IGL02972:Zan	APN	5	137463686	missense	unknown
IGL03068:Zan	APN	5	137476415	missense	probably damaging	1.00
IGL03104:Zan	APN	5	137463500	missense	unknown
IGL03110:Zan	APN	5	137420016	missense	unknown
IGL03156:Zan	APN	5	137463939	missense	unknown
IGL03302:Zan	APN	5	137468390	missense	possibly damaging	0.93
IGL03307:Zan	APN	5	137474025	missense	probably damaging	0.99
IGL03340:Zan	APN	5	137427874	missense	unknown
IGL03379:Zan	APN	5	137464215	missense	unknown
IGL03405:Zan	APN	5	137424597	missense	unknown
Befallen	UTSW	5	137412676	unclassified	probably benign
befell	UTSW	5	137446037	splice site	probably null
R3853_zan_008	UTSW	5	137474064	missense	probably damaging	1.00
BB010:Zan	UTSW	5	137463579	missense	unknown
BB020:Zan	UTSW	5	137463579	missense	unknown
G1patch:Zan	UTSW	5	137438520	missense	unknown
PIT4283001:Zan	UTSW	5	137400093	missense	unknown
PIT4431001:Zan	UTSW	5	137392064	missense	unknown
PIT4498001:Zan	UTSW	5	137417036	critical splice donor site	probably null
R0027:Zan	UTSW	5	137406519	unclassified	probably benign
R0047:Zan	UTSW	5	137403656	missense	unknown
R0149:Zan	UTSW	5	137396766	missense	unknown
R0240:Zan	UTSW	5	137398362	missense	unknown
R0240:Zan	UTSW	5	137398362	missense	unknown
R0241:Zan	UTSW	5	137421822	missense	unknown
R0241:Zan	UTSW	5	137421822	missense	unknown
R0361:Zan	UTSW	5	137396766	missense	unknown
R0432:Zan	UTSW	5	137382316	unclassified	probably benign
R0436:Zan	UTSW	5	137464902	missense	unknown
R0446:Zan	UTSW	5	137391658	missense	unknown
R0457:Zan	UTSW	5	137407706	unclassified	probably benign
R0478:Zan	UTSW	5	137400526	splice site	probably benign
R0487:Zan	UTSW	5	137413358	critical splice donor site	probably null
R0497:Zan	UTSW	5	137412676	unclassified	probably benign
R0504:Zan	UTSW	5	137470318	missense	probably damaging	1.00
R0545:Zan	UTSW	5	137396177	missense	unknown
R0556:Zan	UTSW	5	137454220	missense	unknown
R0615:Zan	UTSW	5	137468431	missense	probably damaging	1.00
R0737:Zan	UTSW	5	137389249	missense	unknown
R0835:Zan	UTSW	5	137408397	unclassified	probably benign
R0863:Zan	UTSW	5	137458639	missense	unknown
R0971:Zan	UTSW	5	137434063	missense	unknown
R1327:Zan	UTSW	5	137465911	splice site	probably benign
R1338:Zan	UTSW	5	137393651	nonsense	probably null
R1413:Zan	UTSW	5	137427939	missense	unknown
R1446:Zan	UTSW	5	137389360	missense	unknown
R1464:Zan	UTSW	5	137419929	missense	unknown
R1464:Zan	UTSW	5	137419929	missense	unknown
R1561:Zan	UTSW	5	137380838	nonsense	probably null
R1569:Zan	UTSW	5	137429130	missense	unknown
R1575:Zan	UTSW	5	137461952	missense	unknown
R1618:Zan	UTSW	5	137383830	missense	unknown
R1634:Zan	UTSW	5	137412790	unclassified	probably benign
R1650:Zan	UTSW	5	137394601	splice site	probably benign
R1680:Zan	UTSW	5	137403050	missense	unknown
R1698:Zan	UTSW	5	137409669	utr 3 prime	probably benign
R1704:Zan	UTSW	5	137434002	nonsense	probably null
R1728:Zan	UTSW	5	137415018	unclassified	probably benign
R1729:Zan	UTSW	5	137415018	unclassified	probably benign
R1769:Zan	UTSW	5	137464518	missense	unknown
R1774:Zan	UTSW	5	137419989	missense	unknown
R1800:Zan	UTSW	5	137386451	missense	unknown
R1858:Zan	UTSW	5	137405877	unclassified	probably benign
R1888:Zan	UTSW	5	137389328	missense	unknown
R1888:Zan	UTSW	5	137389328	missense	unknown
R1925:Zan	UTSW	5	137425642	missense	unknown
R1938:Zan	UTSW	5	137388939	missense	unknown
R1955:Zan	UTSW	5	137389283	missense	unknown
R1989:Zan	UTSW	5	137420006	nonsense	probably null
R1997:Zan	UTSW	5	137403114	nonsense	probably null
R2008:Zan	UTSW	5	137452450	missense	unknown
R2035:Zan	UTSW	5	137443947	missense	unknown
R2153:Zan	UTSW	5	137436400	missense	unknown
R2154:Zan	UTSW	5	137414249	unclassified	probably benign
R2176:Zan	UTSW	5	137421848	missense	unknown
R2217:Zan	UTSW	5	137410306	utr 3 prime	probably benign
R2218:Zan	UTSW	5	137410306	utr 3 prime	probably benign
R2237:Zan	UTSW	5	137457837	nonsense	probably null
R2239:Zan	UTSW	5	137457837	nonsense	probably null
R2346:Zan	UTSW	5	137421867	missense	unknown
R2360:Zan	UTSW	5	137396126	missense	unknown
R2389:Zan	UTSW	5	137476380	critical splice donor site	probably null
R2412:Zan	UTSW	5	137414163	splice site	probably null
R2426:Zan	UTSW	5	137388992	missense	unknown
R2435:Zan	UTSW	5	137438574	missense	unknown
R2509:Zan	UTSW	5	137456586	missense	unknown
R3416:Zan	UTSW	5	137435720	missense	unknown
R3691:Zan	UTSW	5	137420019	missense	unknown
R3853:Zan	UTSW	5	137474064	missense	probably damaging	1.00
R4006:Zan	UTSW	5	137463939	missense	unknown
R4007:Zan	UTSW	5	137463939	missense	unknown
R4033:Zan	UTSW	5	137437860	nonsense	probably null
R4059:Zan	UTSW	5	137436820	missense	unknown
R4109:Zan	UTSW	5	137458619	missense	unknown
R4194:Zan	UTSW	5	137463555	missense	unknown
R4226:Zan	UTSW	5	137423978	missense	unknown
R4457:Zan	UTSW	5	137411516	missense	unknown
R4544:Zan	UTSW	5	137383834	missense	unknown
R4546:Zan	UTSW	5	137383834	missense	unknown
R4642:Zan	UTSW	5	137464188	missense	unknown
R4708:Zan	UTSW	5	137446712	missense	unknown
R4773:Zan	UTSW	5	137436313	splice site	probably benign
R4774:Zan	UTSW	5	137389019	missense	unknown
R4788:Zan	UTSW	5	137442113	missense	unknown
R4795:Zan	UTSW	5	137380850	nonsense	probably null
R4796:Zan	UTSW	5	137380850	nonsense	probably null
R4812:Zan	UTSW	5	137456285	missense	unknown
R4832:Zan	UTSW	5	137393161	missense	unknown
R4882:Zan	UTSW	5	137438448	missense	unknown
R4896:Zan	UTSW	5	137386456	missense	unknown
R4921:Zan	UTSW	5	137408370	unclassified	probably benign
R4943:Zan	UTSW	5	137457890	missense	unknown
R4978:Zan	UTSW	5	137406921	unclassified	probably benign
R5013:Zan	UTSW	5	137383837	missense	unknown
R5024:Zan	UTSW	5	137461893	nonsense	probably null
R5230:Zan	UTSW	5	137454078	missense	unknown
R5354:Zan	UTSW	5	137380788	unclassified	probably benign
R5380:Zan	UTSW	5	137457840	missense	unknown
R5394:Zan	UTSW	5	137435634	missense	unknown
R5394:Zan	UTSW	5	137464074	missense	unknown
R5435:Zan	UTSW	5	137403762	missense	unknown
R5441:Zan	UTSW	5	137436751	missense	unknown
R5447:Zan	UTSW	5	137472191	missense	probably damaging	1.00
R5455:Zan	UTSW	5	137454000	missense	unknown
R5495:Zan	UTSW	5	137470408	missense	probably damaging	1.00
R5496:Zan	UTSW	5	137436345	missense	unknown
R5523:Zan	UTSW	5	137421893	missense	unknown
R5534:Zan	UTSW	5	137438451	missense	unknown
R5572:Zan	UTSW	5	137394431	missense	unknown
R5576:Zan	UTSW	5	137428482	nonsense	probably null
R5587:Zan	UTSW	5	137391762	missense	unknown
R5593:Zan	UTSW	5	137468338	missense	possibly damaging	0.72
R5600:Zan	UTSW	5	137386971	missense	unknown
R5682:Zan	UTSW	5	137414259	nonsense	probably null
R5712:Zan	UTSW	5	137400098	missense	unknown
R5751:Zan	UTSW	5	137410161	splice site	probably null
R5782:Zan	UTSW	5	137420007	missense	unknown
R5835:Zan	UTSW	5	137456655	missense	unknown
R5846:Zan	UTSW	5	137394376	splice site	probably null
R5903:Zan	UTSW	5	137442134	missense	unknown
R5911:Zan	UTSW	5	137457912	missense	unknown
R5935:Zan	UTSW	5	137443930	missense	unknown
R5985:Zan	UTSW	5	137446037	splice site	probably null
R5995:Zan	UTSW	5	137378809	unclassified	probably benign
R6012:Zan	UTSW	5	137464529	missense	unknown
R6077:Zan	UTSW	5	137414297	unclassified	probably benign
R6227:Zan	UTSW	5	137468343	missense	probably damaging	0.96
R6262:Zan	UTSW	5	137429485	splice site	probably null
R6337:Zan	UTSW	5	137452488	missense	unknown
R6598:Zan	UTSW	5	137406364	unclassified	probably benign
R6725:Zan	UTSW	5	137438520	missense	unknown
R6765:Zan	UTSW	5	137393147	missense	unknown
R6820:Zan	UTSW	5	137407844	unclassified	probably benign
R6829:Zan	UTSW	5	137416278	unclassified	probably benign
R6851:Zan	UTSW	5	137396191	missense	unknown
R6903:Zan	UTSW	5	137456304	missense	unknown
R6968:Zan	UTSW	5	137461813	missense	unknown
R7021:Zan	UTSW	5	137423951	missense	unknown
R7039:Zan	UTSW	5	137400134	missense	unknown
R7101:Zan	UTSW	5	137398290	missense	unknown
R7102:Zan	UTSW	5	137454200	critical splice donor site	probably null
R7155:Zan	UTSW	5	137461844	missense	unknown
R7158:Zan	UTSW	5	137400644	missense	unknown
R7170:Zan	UTSW	5	137463494	missense	unknown
R7203:Zan	UTSW	5	137434096	missense	unknown
R7204:Zan	UTSW	5	137427978	missense	unknown
R7305:Zan	UTSW	5	137415139	missense	unknown
R7327:Zan	UTSW	5	137465232	missense	probably benign	0.35
R7340:Zan	UTSW	5	137383830	missense	unknown
R7360:Zan	UTSW	5	137386970	missense	unknown
R7385:Zan	UTSW	5	137434154	nonsense	probably null
R7385:Zan	UTSW	5	137450491	missense	unknown
R7438:Zan	UTSW	5	137425562	missense	unknown
R7453:Zan	UTSW	5	137466002	missense	probably damaging	1.00
R7483:Zan	UTSW	5	137446795	missense	unknown
R7499:Zan	UTSW	5	137464356	missense	probably benign	0.23
R7566:Zan	UTSW	5	137412583	critical splice donor site	probably null
R7641:Zan	UTSW	5	137467108	missense	possibly damaging	0.74
R7674:Zan	UTSW	5	137467108	missense	possibly damaging	0.74
R7678:Zan	UTSW	5	137463540	missense	unknown
R7785:Zan	UTSW	5	137429143	missense	unknown
R7814:Zan	UTSW	5	137463579	missense	unknown
R7841:Zan	UTSW	5	137436802	missense	unknown
R7861:Zan	UTSW	5	137407033	missense	unknown
R7869:Zan	UTSW	5	137473601	missense	probably damaging	1.00
R7933:Zan	UTSW	5	137463579	missense	unknown
R7934:Zan	UTSW	5	137463579	missense	unknown
R7935:Zan	UTSW	5	137463579	missense	unknown
R7960:Zan	UTSW	5	137409603	missense	unknown
R7960:Zan	UTSW	5	137464892	missense	unknown
R7990:Zan	UTSW	5	137393090	missense	unknown
R8008:Zan	UTSW	5	137405362	missense	unknown
R8025:Zan	UTSW	5	137406352	missense	unknown
R8061:Zan	UTSW	5	137436631	missense	unknown
R8190:Zan	UTSW	5	137467084	missense	probably damaging	1.00
R8202:Zan	UTSW	5	137389327	missense	unknown
R8302:Zan	UTSW	5	137409661	missense	unknown
R8305:Zan	UTSW	5	137450551	missense	unknown
R8328:Zan	UTSW	5	137394464	missense	unknown
R8377:Zan	UTSW	5	137391687	missense	unknown
R8404:Zan	UTSW	5	137398332	missense	unknown
R8502:Zan	UTSW	5	137473583	missense	probably damaging	1.00
R8510:Zan	UTSW	5	137388938	missense	unknown
R8511:Zan	UTSW	5	137446846	missense	unknown
R8527:Zan	UTSW	5	137435709	missense	unknown
R8695:Zan	UTSW	5	137386955	missense	unknown
R8708:Zan	UTSW	5	137463277	critical splice donor site	probably null
R8744:Zan	UTSW	5	137427864	missense	unknown
R8795:Zan	UTSW	5	137398260	missense	unknown
R8841:Zan	UTSW	5	137456674	missense	unknown
R8862:Zan	UTSW	5	137474412	missense	probably benign	0.28
R8937:Zan	UTSW	5	137395626	missense	unknown
R8973:Zan	UTSW	5	137389316	missense	unknown
R8988:Zan	UTSW	5	137408301	missense	unknown
R8995:Zan	UTSW	5	137395620	missense	unknown
R9036:Zan	UTSW	5	137465944	missense	probably damaging	1.00
R9037:Zan	UTSW	5	137454316	missense	unknown
R9061:Zan	UTSW	5	137464391	missense	probably damaging	0.98
R9077:Zan	UTSW	5	137403206	missense	unknown
R9164:Zan	UTSW	5	137424071	missense	unknown
R9186:Zan	UTSW	5	137393548	missense	unknown
R9222:Zan	UTSW	5	137467201	missense	possibly damaging	0.56
R9224:Zan	UTSW	5	137474007	missense	probably damaging	1.00
R9277:Zan	UTSW	5	137463992	missense	unknown
R9296:Zan	UTSW	5	137388876	missense	unknown
R9300:Zan	UTSW	5	137470257	critical splice donor site	probably null
R9352:Zan	UTSW	5	137436483	missense	unknown
R9382:Zan	UTSW	5	137391655	missense	unknown
R9393:Zan	UTSW	5	137405420	missense	unknown
R9534:Zan	UTSW	5	137409683	nonsense	probably null
R9548:Zan	UTSW	5	137403061	missense	unknown
R9564:Zan	UTSW	5	137406426	missense	unknown
R9623:Zan	UTSW	5	137463374	missense	unknown
R9643:Zan	UTSW	5	137458550	missense	unknown
R9648:Zan	UTSW	5	137407730	missense	unknown
R9663:Zan	UTSW	5	137380857	missense	unknown
R9683:Zan	UTSW	5	137464514	missense	unknown
R9688:Zan	UTSW	5	137468455	missense	probably damaging	1.00
R9700:Zan	UTSW	5	137456574	missense	unknown
R9715:Zan	UTSW	5	137400555	missense	unknown
R9722:Zan	UTSW	5	137389062	missense	unknown
RF013:Zan	UTSW	5	137391720	missense	unknown
X0062:Zan	UTSW	5	137446238	missense	unknown
X0066:Zan	UTSW	5	137464430	missense	probably benign	0.00
Z1176:Zan	UTSW	5	137393597	missense	unknown
Z1176:Zan	UTSW	5	137398362	missense	unknown
Z1176:Zan	UTSW	5	137411588	missense	unknown
Z1177:Zan	UTSW	5	137383733	missense	unknown
Z1177:Zan	UTSW	5	137389061	missense	unknown
Z1177:Zan	UTSW	5	137393105	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTAGCTCTCCTGTTTCTAAGGAC -3'
(R):5'- TCATGAACTCTCTGCCTGGC -3'

Sequencing Primer
(F):5'- CTAGTAGGATCCCTGGAATTACAGAC -3'
(R):5'- TCCCCACAGCTCTGCAGTG -3'

Posted On

2018-11-06