Incidental Mutation 'R6910:Gm9268'
ID 538976
Institutional Source Beutler Lab
Gene Symbol Gm9268
Ensembl Gene ENSMUSG00000091528
Gene Name predicted gene 9268
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43018798-43048106 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43024051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 178 (F178L)
Ref Sequence ENSEMBL: ENSMUSP00000134441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166914] [ENSMUST00000173815]
AlphaFold E9Q0M3
Predicted Effect probably benign
Transcript: ENSMUST00000166914
AA Change: F185L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129068
Gene: ENSMUSG00000091528
AA Change: F185L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 473 1.1e-41 PFAM
Pfam:NCD3G 516 569 1.7e-23 PFAM
Pfam:7tm_3 602 837 9.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173815
AA Change: F178L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000134441
Gene: ENSMUSG00000091528
AA Change: F178L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 5.3e-40 PFAM
Pfam:NCD3G 509 562 4.6e-22 PFAM
Pfam:7tm_3 594 831 1.1e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Gm9268
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Gm9268 APN 7 43024709 missense probably damaging 0.97
IGL01753:Gm9268 APN 7 43024715 missense probably damaging 1.00
IGL02338:Gm9268 APN 7 43047736 missense probably damaging 1.00
IGL02541:Gm9268 APN 7 43023668 splice site probably benign
R0751:Gm9268 UTSW 7 43047409 missense probably damaging 0.99
R0849:Gm9268 UTSW 7 43024718 missense probably damaging 1.00
R1460:Gm9268 UTSW 7 43023215 missense probably benign 0.25
R1617:Gm9268 UTSW 7 43024079 missense probably benign 0.18
R1962:Gm9268 UTSW 7 43047400 missense probably benign 0.00
R1999:Gm9268 UTSW 7 43047459 missense probably damaging 1.00
R2022:Gm9268 UTSW 7 43024030 missense probably benign
R2434:Gm9268 UTSW 7 43047457 missense probably damaging 0.99
R3760:Gm9268 UTSW 7 43024078 missense probably benign 0.00
R4562:Gm9268 UTSW 7 43023562 nonsense probably null
R4890:Gm9268 UTSW 7 43047600 missense probably damaging 1.00
R5221:Gm9268 UTSW 7 43023260 missense probably benign 0.31
R5597:Gm9268 UTSW 7 43024649 missense probably benign 0.01
R6589:Gm9268 UTSW 7 43023598 missense possibly damaging 0.91
R6831:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6834:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6944:Gm9268 UTSW 7 43047969 missense possibly damaging 0.95
R7470:Gm9268 UTSW 7 43047886 missense probably damaging 1.00
R7553:Gm9268 UTSW 7 43048023 missense probably damaging 1.00
R7661:Gm9268 UTSW 7 43023158 missense probably benign 0.00
R7677:Gm9268 UTSW 7 43024739 missense probably damaging 1.00
R8087:Gm9268 UTSW 7 43047670 missense probably benign 0.04
R8210:Gm9268 UTSW 7 43024038 missense probably benign 0.16
R8379:Gm9268 UTSW 7 43047846 missense probably damaging 1.00
R8692:Gm9268 UTSW 7 43047684 missense probably benign 0.13
R8917:Gm9268 UTSW 7 43048009 missense probably damaging 1.00
R9255:Gm9268 UTSW 7 43024541 missense possibly damaging 0.75
R9375:Gm9268 UTSW 7 43024075 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGTACTTGATGACAGATCCAC -3'
(R):5'- TTTTCACAAAGGCTAAGCAGATCC -3'

Sequencing Primer
(F):5'- GGTACTTGATGACAGATCCACATTTC -3'
(R):5'- AGGCTAAGCAGATCCTATTACTTTCC -3'
Posted On 2018-11-06