Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Sez6'

538986

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77953869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 173 (T173A)

Ref Sequence

ENSEMBL: ENSMUSP00000000646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000646
AA Change: T173A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: T173A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093995
AA Change: T173A

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: T173A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632
AA Change: T6A

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4894:Sez6	UTSW	11	77975260	missense	probably damaging	1.00
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6126:Sez6	UTSW	11	77973804	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6897:Sez6	UTSW	11	77953559	missense	probably damaging	1.00
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7405:Sez6	UTSW	11	77962891	missense	probably benign	0.10
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R8973:Sez6	UTSW	11	77974571	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTTTACCAGTCCGACTCCAG -3'
(R):5'- CAGAGGCATTTAGGGATCGTGG -3'

Sequencing Primer
(F):5'- AGTCCGACTCCAGCCGTG -3'
(R):5'- TAGCTGACCTGGTGGCTGAAC -3'

Posted On

2018-11-06