Incidental Mutation 'R6910:Gpatch2l'
ID 538987
Institutional Source Beutler Lab
Gene Symbol Gpatch2l
Ensembl Gene ENSMUSG00000021254
Gene Name G patch domain containing 2 like
Synonyms 1700020O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 86241858-86291784 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86244184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 47 (R47H)
Ref Sequence ENSEMBL: ENSMUSP00000152284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000221368]
AlphaFold Q6PE65
Predicted Effect probably damaging
Transcript: ENSMUST00000071106
AA Change: R47H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254
AA Change: R47H

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221368
AA Change: R47H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1427 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Gpatch2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02335:Gpatch2l APN 12 86256937 splice site probably benign
IGL02458:Gpatch2l APN 12 86288961 utr 3 prime probably benign
IGL03131:Gpatch2l APN 12 86281511 missense probably benign 0.00
R0546:Gpatch2l UTSW 12 86288848 makesense probably null
R1349:Gpatch2l UTSW 12 86260709 missense possibly damaging 0.94
R1368:Gpatch2l UTSW 12 86260665 missense possibly damaging 0.73
R1600:Gpatch2l UTSW 12 86256934 critical splice donor site probably null
R1701:Gpatch2l UTSW 12 86288952 missense probably benign 0.00
R2656:Gpatch2l UTSW 12 86288810 missense probably damaging 1.00
R3149:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3150:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3176:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3177:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3276:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3277:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R4342:Gpatch2l UTSW 12 86260679 missense probably benign 0.00
R5161:Gpatch2l UTSW 12 86267176 missense probably benign 0.17
R5712:Gpatch2l UTSW 12 86244480 missense probably damaging 1.00
R6343:Gpatch2l UTSW 12 86260605 nonsense probably null
R6899:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6911:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6912:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6917:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6930:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6994:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6995:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6996:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6998:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6999:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7000:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7001:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7002:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7003:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7010:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7011:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7203:Gpatch2l UTSW 12 86288937 missense probably benign 0.40
R7239:Gpatch2l UTSW 12 86260575 critical splice acceptor site probably null
R7327:Gpatch2l UTSW 12 86256872 missense probably damaging 1.00
R7419:Gpatch2l UTSW 12 86265251 critical splice donor site probably null
R8231:Gpatch2l UTSW 12 86244189 missense probably damaging 1.00
R8876:Gpatch2l UTSW 12 86261631 missense probably damaging 0.99
R9189:Gpatch2l UTSW 12 86244378 missense probably benign 0.13
R9284:Gpatch2l UTSW 12 86244109 missense probably benign 0.01
R9432:Gpatch2l UTSW 12 86260634
Predicted Primers PCR Primer
(F):5'- AGCCGGTCTTCTCAAGCATC -3'
(R):5'- TGCTTACCCCTAATGATGGC -3'

Sequencing Primer
(F):5'- TCTCAAGCATCATTCTTCATCAAG -3'
(R):5'- TTACCCCTAATGATGGCACTGAGAG -3'
Posted On 2018-11-06