Incidental Mutation 'R6910:R3hcc1'
ID 538989
Institutional Source Beutler Lab
Gene Symbol R3hcc1
Ensembl Gene ENSMUSG00000034194
Gene Name R3H domain and coiled-coil containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 69697307-69707584 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69697575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 454 (P454L)
Ref Sequence ENSEMBL: ENSMUSP00000150058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022660] [ENSMUST00000100420] [ENSMUST00000118374] [ENSMUST00000121142] [ENSMUST00000216152]
AlphaFold Q8BSI6
Predicted Effect probably benign
Transcript: ENSMUST00000022660
SMART Domains Protein: ENSMUSP00000022660
Gene: ENSMUSG00000034205

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 753 1.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100420
SMART Domains Protein: ENSMUSP00000097987
Gene: ENSMUSG00000034205

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 750 1.1e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118374
AA Change: P454L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113450
Gene: ENSMUSG00000034194
AA Change: P454L

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121142
AA Change: P454L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113898
Gene: ENSMUSG00000034194
AA Change: P454L

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216152
AA Change: P454L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7561 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in R3hcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:R3hcc1 APN 14 69700028 missense probably damaging 0.99
IGL02089:R3hcc1 APN 14 69700026 missense possibly damaging 0.90
R3737:R3hcc1 UTSW 14 69697593 missense probably benign 0.33
R4041:R3hcc1 UTSW 14 69706662 missense probably damaging 1.00
R4512:R3hcc1 UTSW 14 69698611 missense probably damaging 1.00
R5058:R3hcc1 UTSW 14 69704014 missense probably damaging 1.00
R5159:R3hcc1 UTSW 14 69697604 critical splice acceptor site probably null
R5520:R3hcc1 UTSW 14 69698608 nonsense probably null
R7019:R3hcc1 UTSW 14 69704125 missense probably damaging 1.00
R7148:R3hcc1 UTSW 14 69705552 missense possibly damaging 0.92
R7392:R3hcc1 UTSW 14 69705880 critical splice acceptor site probably null
R7792:R3hcc1 UTSW 14 69705508 missense probably benign
R7975:R3hcc1 UTSW 14 69707144 missense probably damaging 1.00
R8393:R3hcc1 UTSW 14 69705441 missense probably benign 0.15
Z1177:R3hcc1 UTSW 14 69705327 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACTAAAGCCTGCTGTGCC -3'
(R):5'- GAAATATGGGCCTGGAGTCCTC -3'

Sequencing Primer
(F):5'- TAAAGCCTGCTGTGCCCCATAG -3'
(R):5'- TCCTGGACCCCTCTCACAAG -3'
Posted On 2018-11-06