Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Nrip1'

538991

Institutional Source

Beutler Lab

Gene Symbol

Nrip1

Ensembl Gene

ENSMUSG00000048490

Gene Name

nuclear receptor interacting protein 1

Synonyms

RIP140, 6030458L20Rik, 8430438I05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76287400-76373827 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76294417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 84 (A84V)

Ref Sequence

ENSEMBL: ENSMUSP00000112959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]

AlphaFold

Q8CBD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000054178
AA Change: A84V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: A84V

Domain	Start	End	E-Value	Type
low complexity region	182	195	N/A	INTRINSIC
low complexity region	252	261	N/A	INTRINSIC
PDB:2GPP\|D	368	392	2e-7	PDB
low complexity region	707	718	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121927
AA Change: A84V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: A84V

Domain	Start	End	E-Value	Type
Pfam:NRIP1_repr_1	27	331	5.4e-141	PFAM
PDB:2GPP\|D	368	392	2e-7	PDB
Pfam:NRIP1_repr_2	412	739	7.5e-122	PFAM
Pfam:NRIP1_repr_3	754	841	8.4e-45	PFAM
Pfam:NRIP1_repr_4	849	1161	1.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140483

Predicted Effect

probably benign
Transcript: ENSMUST00000231585

Meta Mutation Damage Score

0.4859

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Map3k8	A	G	18: 4,340,801	I171T	probably benign	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Nrip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Nrip1	APN	16	76293703	missense	possibly damaging	0.48
IGL00732:Nrip1	APN	16	76293061	missense	probably benign	0.31
IGL02024:Nrip1	APN	16	76291675	missense	probably benign	0.05
IGL02172:Nrip1	APN	16	76291492	missense	probably damaging	0.99
IGL02432:Nrip1	APN	16	76291780	missense	probably benign	0.04
IGL03025:Nrip1	APN	16	76294465	missense	probably benign	0.06
IGL03410:Nrip1	APN	16	76292491	missense	probably benign
PIT4802001:Nrip1	UTSW	16	76293269	missense	probably damaging	0.97
R0064:Nrip1	UTSW	16	76294670	utr 5 prime	probably benign
R0304:Nrip1	UTSW	16	76292707	missense	possibly damaging	0.67
R0320:Nrip1	UTSW	16	76292363	missense	probably benign	0.00
R0368:Nrip1	UTSW	16	76294016	missense	probably damaging	0.99
R1730:Nrip1	UTSW	16	76292890	missense	probably benign	0.42
R1783:Nrip1	UTSW	16	76292890	missense	probably benign	0.42
R1850:Nrip1	UTSW	16	76293344	missense	probably damaging	1.00
R1900:Nrip1	UTSW	16	76292039	missense	probably benign
R2252:Nrip1	UTSW	16	76291285	missense	probably damaging	1.00
R3935:Nrip1	UTSW	16	76294435	missense	possibly damaging	0.67
R4290:Nrip1	UTSW	16	76291988	missense	probably benign	0.00
R4426:Nrip1	UTSW	16	76291405	missense	possibly damaging	0.87
R4598:Nrip1	UTSW	16	76293080	missense	probably damaging	1.00
R4607:Nrip1	UTSW	16	76293032	missense	probably benign	0.00
R4608:Nrip1	UTSW	16	76293032	missense	probably benign	0.00
R5893:Nrip1	UTSW	16	76293953	missense	probably damaging	1.00
R5939:Nrip1	UTSW	16	76292122	missense	probably damaging	0.99
R5966:Nrip1	UTSW	16	76293583	missense	possibly damaging	0.47
R6093:Nrip1	UTSW	16	76294764	start gained	probably benign
R6154:Nrip1	UTSW	16	76293830	missense	probably damaging	1.00
R6639:Nrip1	UTSW	16	76293995	nonsense	probably null
R6921:Nrip1	UTSW	16	76292588	missense	possibly damaging	0.88
R7314:Nrip1	UTSW	16	76291190	missense	probably benign	0.00
R7346:Nrip1	UTSW	16	76293356	missense	possibly damaging	0.81
R7386:Nrip1	UTSW	16	76293887	missense	probably damaging	1.00
R7485:Nrip1	UTSW	16	76291450	missense	probably damaging	1.00
R7506:Nrip1	UTSW	16	76294459	missense	probably damaging	1.00
R7517:Nrip1	UTSW	16	76291184	makesense	probably null
R7657:Nrip1	UTSW	16	76294699	splice site	probably null
R7878:Nrip1	UTSW	16	76294666	start codon destroyed	probably null	0.99
R8068:Nrip1	UTSW	16	76292953	missense	possibly damaging	0.62
R8254:Nrip1	UTSW	16	76291399	missense	probably benign	0.02
R8261:Nrip1	UTSW	16	76292061	missense	possibly damaging	0.69
R8294:Nrip1	UTSW	16	76292530	missense	probably damaging	1.00
R8723:Nrip1	UTSW	16	76292665	missense	probably damaging	0.98
R8739:Nrip1	UTSW	16	76291348	missense	possibly damaging	0.51
R8956:Nrip1	UTSW	16	76292305	missense	probably benign	0.07
R8988:Nrip1	UTSW	16	76292014	missense	probably damaging	1.00
R9024:Nrip1	UTSW	16	76291500	nonsense	probably null
R9206:Nrip1	UTSW	16	76292728	missense	possibly damaging	0.93
R9208:Nrip1	UTSW	16	76292728	missense	possibly damaging	0.93
R9393:Nrip1	UTSW	16	76294465	missense	probably benign	0.06
Z1177:Nrip1	UTSW	16	76293479	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCTGTGACAGAGCAACAG -3'
(R):5'- TACCTCGAAGGGTTACTAATGCATC -3'

Sequencing Primer
(F):5'- CTGTGACAGAGCAACAGTCTGC -3'
(R):5'- CATCAGGCAGCAGGGGGATC -3'

Posted On

2018-11-06