Incidental Mutation 'R6910:Mrpl39'
ID 538992
Institutional Source Beutler Lab
Gene Symbol Mrpl39
Ensembl Gene ENSMUSG00000022889
Gene Name mitochondrial ribosomal protein L39
Synonyms MRP-L5, Rpml5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R6910 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 84717576-84735742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84735192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000112283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116584]
AlphaFold Q9JKF7
Predicted Effect unknown
Transcript: ENSMUST00000116584
AA Change: V9A
SMART Domains Protein: ENSMUSP00000112283
Gene: ENSMUSG00000022889
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
SCOP:d1a04a1 27 69 8e-3 SMART
PDB:4CE4|C 66 335 N/A PDB
SCOP:d1qf6a2 73 126 1e-2 SMART
SCOP:d1qf6a3 128 319 4e-28 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Two transcript variants encoding distinct isoforms have been described. A pseudogene corresponding to this gene is found on chromosome 5q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Mrpl39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Mrpl39 APN 16 84723852 missense probably damaging 1.00
R0671:Mrpl39 UTSW 16 84734394 splice site probably benign
R1682:Mrpl39 UTSW 16 84730459 missense probably damaging 0.99
R2357:Mrpl39 UTSW 16 84727564 missense probably benign 0.00
R2424:Mrpl39 UTSW 16 84730860 missense probably benign
R4418:Mrpl39 UTSW 16 84725124 critical splice donor site probably null
R4976:Mrpl39 UTSW 16 84734405 critical splice donor site probably null
R5375:Mrpl39 UTSW 16 84723902 missense probably damaging 1.00
R5730:Mrpl39 UTSW 16 84732434 missense probably damaging 1.00
R5948:Mrpl39 UTSW 16 84725153 missense probably benign 0.25
R6407:Mrpl39 UTSW 16 84732385 missense probably benign 0.01
R8519:Mrpl39 UTSW 16 84730848 missense probably benign 0.13
R9309:Mrpl39 UTSW 16 84735183 missense unknown
Z1176:Mrpl39 UTSW 16 84723972 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGACATGTTTGCCGAAGAC -3'
(R):5'- TAGACACTTCTGCGACTCCTCAG -3'

Sequencing Primer
(F):5'- GACTGGGGCTCCTAAAACC -3'
(R):5'- CCAAGGGTGAGCCATCCAAG -3'
Posted On 2018-11-06