Incidental Mutation 'R6911:Pdlim5'
ID539009
Institutional Source Beutler Lab
Gene Symbol Pdlim5
Ensembl Gene ENSMUSG00000028273
Gene NamePDZ and LIM domain 5
SynonymsEnh3, Enh, Enh2, 1110001A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142239590-142395696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142304315 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 289 (I289V)
Ref Sequence ENSEMBL: ENSMUSP00000029941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029941] [ENSMUST00000058626] [ENSMUST00000090134] [ENSMUST00000168967] [ENSMUST00000170361] [ENSMUST00000195975] [ENSMUST00000196220] [ENSMUST00000196908] [ENSMUST00000198381] [ENSMUST00000200043]
PDB Structure
Solution structure of the PDZ domain of Enigma homologue protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029941
AA Change: I289V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029941
Gene: ENSMUSG00000028273
AA Change: I289V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Pfam:DUF4749 212 305 1.3e-9 PFAM
low complexity region 310 339 N/A INTRINSIC
LIM 414 465 3.17e-17 SMART
LIM 473 524 4.62e-19 SMART
LIM 532 585 1.79e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000058626
AA Change: I191V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059267
Gene: ENSMUSG00000028273
AA Change: I191V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090134
AA Change: I166V

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087595
Gene: ENSMUSG00000028273
AA Change: I166V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 111 118 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168967
AA Change: I186V

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132647
Gene: ENSMUSG00000028273
AA Change: I186V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170361
AA Change: I191V

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128752
Gene: ENSMUSG00000028273
AA Change: I191V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Pfam:DUF4749 101 207 2.7e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195975
AA Change: I180V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142737
Gene: ENSMUSG00000028273
AA Change: I180V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 237 246 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
low complexity region 333 362 N/A INTRINSIC
LIM 437 488 3.17e-17 SMART
LIM 496 547 4.62e-19 SMART
LIM 555 608 1.79e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196220
AA Change: I180V

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142460
Gene: ENSMUSG00000028273
AA Change: I180V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
low complexity region 293 322 N/A INTRINSIC
LIM 397 448 3.17e-17 SMART
LIM 456 507 4.62e-19 SMART
LIM 515 568 1.79e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196908
AA Change: I289V

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143098
Gene: ENSMUSG00000028273
AA Change: I289V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000198381
AA Change: I180V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142899
Gene: ENSMUSG00000028273
AA Change: I180V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 201 230 N/A INTRINSIC
LIM 305 356 3.17e-17 SMART
LIM 364 415 4.62e-19 SMART
LIM 423 476 1.79e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200043
AA Change: I180V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143343
Gene: ENSMUSG00000028273
AA Change: I180V

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 228 243 N/A INTRINSIC
low complexity region 245 274 N/A INTRINSIC
LIM 349 400 3.17e-17 SMART
LIM 408 459 4.62e-19 SMART
LIM 467 520 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200650
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cardiac muscle contractility, wider Z-lines, and dilated cardiomyopathy. Mice heterozygous for a gene trap allele exhibit impaired response to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Pdlim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Pdlim5 APN 3 142352787 missense probably damaging 1.00
R1868:Pdlim5 UTSW 3 142306299 critical splice acceptor site probably null
R1937:Pdlim5 UTSW 3 142244981 missense possibly damaging 0.46
R3000:Pdlim5 UTSW 3 142312131 missense probably damaging 1.00
R4477:Pdlim5 UTSW 3 142259217 missense probably benign 0.09
R4959:Pdlim5 UTSW 3 142311979 intron probably benign
R4973:Pdlim5 UTSW 3 142311979 intron probably benign
R5135:Pdlim5 UTSW 3 142304365 missense probably benign 0.34
R5393:Pdlim5 UTSW 3 142259186 missense probably damaging 1.00
R5445:Pdlim5 UTSW 3 142352734 missense probably null 1.00
R5707:Pdlim5 UTSW 3 142304299 missense probably damaging 1.00
R6154:Pdlim5 UTSW 3 142277913 missense possibly damaging 0.68
R6269:Pdlim5 UTSW 3 142312325 missense possibly damaging 0.57
R6395:Pdlim5 UTSW 3 142314422 missense probably damaging 1.00
R6600:Pdlim5 UTSW 3 142259278 missense probably damaging 1.00
R7135:Pdlim5 UTSW 3 142311922 intron probably null
R7283:Pdlim5 UTSW 3 142311980 critical splice acceptor site probably null
R7334:Pdlim5 UTSW 3 142244917 missense probably damaging 1.00
R7660:Pdlim5 UTSW 3 142259185 missense probably damaging 1.00
R7687:Pdlim5 UTSW 3 142277847 missense probably benign 0.02
R7696:Pdlim5 UTSW 3 142277862 missense probably benign 0.08
R7779:Pdlim5 UTSW 3 142242686 missense probably benign 0.27
R7904:Pdlim5 UTSW 3 142312393 missense probably damaging 1.00
R7987:Pdlim5 UTSW 3 142312393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTGCGATTCCCTGGAC -3'
(R):5'- ACCCTTTAGCACAGTTTACTCTAAC -3'

Sequencing Primer
(F):5'- GGACTGGAATCTTCTTTTGTACAAC -3'
(R):5'- GCACAGTTTACTCTAACCTATACATG -3'
Posted On2018-11-06