Incidental Mutation 'R6911:Olfr1331'
ID539014
Institutional Source Beutler Lab
Gene Symbol Olfr1331
Ensembl Gene ENSMUSG00000073769
Gene Nameolfactory receptor 1331
SynonymsMOR259-3P, GA_x6K02T2QD9B-18670866-18669913
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118864649-118871707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118869138 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 119 (M119K)
Ref Sequence ENSEMBL: ENSMUSP00000101967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094831] [ENSMUST00000106360] [ENSMUST00000216589]
Predicted Effect probably damaging
Transcript: ENSMUST00000094831
AA Change: M119K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092426
Gene: ENSMUSG00000073769
AA Change: M119K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.1e-53 PFAM
Pfam:7tm_1 42 291 3.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106360
AA Change: M119K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101967
Gene: ENSMUSG00000073769
AA Change: M119K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.2e-28 PFAM
Pfam:7tm_4 139 283 2.8e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216589
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1973 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Olfr1331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr1331 APN 4 118869287 missense probably damaging 1.00
IGL01314:Olfr1331 APN 4 118869131 missense probably benign 0.26
IGL02025:Olfr1331 APN 4 118869165 missense probably damaging 1.00
IGL02458:Olfr1331 APN 4 118869300 missense possibly damaging 0.83
IGL02793:Olfr1331 APN 4 118869597 missense probably damaging 1.00
IGL02827:Olfr1331 APN 4 118868960 missense probably damaging 0.99
IGL02863:Olfr1331 APN 4 118868886 missense possibly damaging 0.52
IGL03125:Olfr1331 APN 4 118868921 missense possibly damaging 0.95
R0078:Olfr1331 UTSW 4 118869227 missense probably benign
R0152:Olfr1331 UTSW 4 118868886 missense possibly damaging 0.89
R0299:Olfr1331 UTSW 4 118869416 missense probably benign 0.00
R3881:Olfr1331 UTSW 4 118869353 missense probably benign 0.00
R3928:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R3929:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R5288:Olfr1331 UTSW 4 118869575 missense probably damaging 1.00
R5552:Olfr1331 UTSW 4 118869468 missense probably damaging 1.00
R5672:Olfr1331 UTSW 4 118869182 missense possibly damaging 0.83
R5773:Olfr1331 UTSW 4 118869521 missense probably damaging 0.97
R6117:Olfr1331 UTSW 4 118869144 missense probably benign 0.39
R6910:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6912:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R7164:Olfr1331 UTSW 4 118869725 missense probably benign 0.30
R7446:Olfr1331 UTSW 4 118868822 missense possibly damaging 0.83
T0975:Olfr1331 UTSW 4 118869303 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCATCATGCTGGTCTGCCTG -3'
(R):5'- ACAAGTAGTGGTTGACCCTGTTG -3'

Sequencing Primer
(F):5'- TGGTCTGCCTGGACACACAG -3'
(R):5'- CCTGTTGGGCCCACAATATG -3'
Posted On2018-11-06