Mutagenetix > Incidental Mutations

Incidental Mutation 'R6911:Sec31a'

539016

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

Sec31 homolog A (S. cerevisiae)

Synonyms

Sec31l1, 1810024J13Rik

MMRRC Submission

Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene?

Probably essential (E-score: 0.865) question?

Stock #

R6911 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100361649-100416234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100393264 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 328 (I328T)

Ref Sequence

ENSEMBL: ENSMUSP00000138213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094578
AA Change: I328T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: I328T

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182886
AA Change: I328T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: I328T

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183247

SMART Domains

Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

Domain	Start	End	E-Value	Type
Pfam:Sec16_C	141	248	1.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,268,353	I459N	probably damaging	Het
4930407I10Rik	T	A	15: 82,063,867	M655K	probably benign	Het
Amt	G	T	9: 108,301,229		probably null	Het
Anapc7	A	T	5: 122,440,280	K443*	probably null	Het
Apcs	A	G	1: 172,894,185	V198A	probably benign	Het
Atp2a1	A	G	7: 126,456,836	V271A	probably damaging	Het
Cdh20	T	C	1: 104,984,686	I555T	possibly damaging	Het
Cgnl1	T	C	9: 71,656,215	E810G	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,014	D101G	probably damaging	Het
Coq7	T	A	7: 118,510,162	H221L	unknown	Het
Depdc5	A	T	5: 32,924,192	Q566L	probably damaging	Het
Dync1i2	G	A	2: 71,247,102	V233I	probably benign	Het
Erp44	G	T	4: 48,204,268	H298N	probably benign	Het
Fam162a	A	G	16: 36,046,377		probably null	Het
Fancd2	A	G	6: 113,548,385	E274G	probably damaging	Het
Fkbp15	G	T	4: 62,340,290	Q147K	probably damaging	Het
Ganab	T	A	19: 8,907,788		probably null	Het
Gfm1	T	C	3: 67,451,303	V409A	possibly damaging	Het
Gm5346	A	T	8: 43,625,109	F693I	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid1	A	T	14: 34,820,228	M1L	probably benign	Het
Helz	C	T	11: 107,619,225	T558I	probably benign	Het
Htra4	A	G	8: 25,025,705	V439A	probably damaging	Het
Kctd17	A	G	15: 78,434,006	E95G	probably damaging	Het
Kif18b	T	C	11: 102,916,380	D43G	probably damaging	Het
Lrpprc	G	A	17: 84,756,283	S550L	possibly damaging	Het
Lrrfip1	T	A	1: 91,114,807	C311*	probably null	Het
Mcoln2	C	T	3: 146,192,256	T44I	probably damaging	Het
Med13l	A	G	5: 118,755,658	T2010A	possibly damaging	Het
Med23	C	T	10: 24,902,181	T803M	probably damaging	Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Myh13	C	T	11: 67,354,927	Q1095*	probably null	Het
Nktr	C	A	9: 121,754,326	Y93*	probably null	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Ntrk2	A	T	13: 58,859,215	E210D	probably damaging	Het
Nup210	G	T	6: 91,030,130	A568E	probably damaging	Het
Olfr1111	T	A	2: 87,149,767	K298I	probably damaging	Het
Olfr1279	A	G	2: 111,306,273	T23A	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr1393	A	G	11: 49,280,807	I220V	probably benign	Het
Pdlim5	T	C	3: 142,304,315	I289V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per1	C	T	11: 69,103,257	T443M	probably damaging	Het
Plxna1	A	G	6: 89,320,974	V1774A	probably damaging	Het
Poteg	A	G	8: 27,450,298	Y165C	probably damaging	Het
Prlr	A	G	15: 10,329,184	T582A	probably benign	Het
Psma5	A	G	3: 108,265,148	E60G	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	T	C	13: 11,827,559	N484S	possibly damaging	Het
Slc12a2	G	T	18: 57,919,469	V787L	probably benign	Het
St14	C	T	9: 31,106,785	R177Q	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tom1l1	G	T	11: 90,644,161		probably null	Het
Ttf1	A	G	2: 29,064,851	R76G	probably benign	Het
Ube4a	C	T	9: 44,942,758	E581K	probably damaging	Het
Vmn2r114	A	G	17: 23,291,130	V792A	probably damaging	Het
Wdr11	T	C	7: 129,607,095	I430T	probably benign	Het
Xkr4	T	C	1: 3,671,321	K10E	possibly damaging	Het
Zfp451	T	C	1: 33,803,456		probably benign	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100404017	nonsense	probably null
IGL01610:Sec31a	APN	5	100402358	splice site	probably benign
IGL01804:Sec31a	APN	5	100375206	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100369626	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100386125	splice site	probably benign
IGL02237:Sec31a	APN	5	100362055	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100385255	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100407193	missense	probably damaging	0.99
control	UTSW	5	100362173	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100363832	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100407275	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100382766	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100404118	splice site	probably benign
R0511:Sec31a	UTSW	5	100375240	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100404070	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100393207	missense	probably damaging	0.97
R0678:Sec31a	UTSW	5	100407225	missense	possibly damaging	0.74
R0975:Sec31a	UTSW	5	100395904	splice site	probably null
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100375319	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100386195	missense	possibly damaging	0.88
R1780:Sec31a	UTSW	5	100381336	splice site	probably null
R2472:Sec31a	UTSW	5	100385205	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100382907	missense	probably damaging	1.00
R4515:Sec31a	UTSW	5	100365958	missense	probably damaging	0.99
R4801:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100393214	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100393321	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100405511	missense	possibly damaging	0.75
R5222:Sec31a	UTSW	5	100382895	missense	probably benign
R5405:Sec31a	UTSW	5	100383798	nonsense	probably null
R5436:Sec31a	UTSW	5	100363839	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100402274	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100363878	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100369594	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100386184	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100386149	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100392499	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100382812	missense	probably benign	0.03
R6936:Sec31a	UTSW	5	100392510	missense	probably benign
R7345:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100392628	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100399477	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100378862	missense
R8555:Sec31a	UTSW	5	100392414	missense	probably benign	0.25
R8762:Sec31a	UTSW	5	100378829	missense	not run
X0003:Sec31a	UTSW	5	100399354	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100383845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGAACTGTGTTGCAACTTTTC -3'
(R):5'- AGCTGCACGTATTACCAGCC -3'

Sequencing Primer
(F):5'- CTGTGTTGCAACTTTTCAACAAC -3'
(R):5'- GCCTTACTTATTTTGCTTATGACCAG -3'

Posted On

2018-11-06