Incidental Mutation 'R6911:Anapc7'
ID539018
Institutional Source Beutler Lab
Gene Symbol Anapc7
Ensembl Gene ENSMUSG00000029466
Gene Nameanaphase promoting complex subunit 7
SynonymsAPC7, prediabetic NOD sera-reactive autoantigen
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122421693-122444912 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 122440280 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 443 (K443*)
Ref Sequence ENSEMBL: ENSMUSP00000113928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031422] [ENSMUST00000119792] [ENSMUST00000122010]
Predicted Effect probably null
Transcript: ENSMUST00000031422
AA Change: K443*
SMART Domains Protein: ENSMUSP00000031422
Gene: ENSMUSG00000029466
AA Change: K443*

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 475 508 4.09e-1 SMART
low complexity region 530 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119792
AA Change: K443*
SMART Domains Protein: ENSMUSP00000112658
Gene: ENSMUSG00000029466
AA Change: K443*

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 442 475 5.76e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122010
AA Change: K443*
SMART Domains Protein: ENSMUSP00000113928
Gene: ENSMUSG00000029466
AA Change: K443*

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 475 508 4.09e-1 SMART
low complexity region 530 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154074
SMART Domains Protein: ENSMUSP00000123365
Gene: ENSMUSG00000029466

DomainStartEndE-ValueType
Blast:TPR 2 28 2e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for proper protein ubiquitination function of APC/C and for the interaction of APC/C with certain transcription coactivators. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Anapc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Anapc7 APN 5 122433477 nonsense probably null
IGL01434:Anapc7 APN 5 122438216 missense probably benign 0.45
IGL01448:Anapc7 APN 5 122428213 missense probably damaging 1.00
IGL01862:Anapc7 APN 5 122440119 missense probably benign
IGL03040:Anapc7 APN 5 122433387 nonsense probably null
IGL03268:Anapc7 APN 5 122429606 critical splice donor site probably null
R0603:Anapc7 UTSW 5 122440170 missense probably benign 0.40
R1497:Anapc7 UTSW 5 122435515 splice site probably benign
R1889:Anapc7 UTSW 5 122433476 missense probably damaging 1.00
R1990:Anapc7 UTSW 5 122439504 missense probably benign 0.38
R2149:Anapc7 UTSW 5 122443826 missense probably benign 0.41
R2877:Anapc7 UTSW 5 122428156 missense probably benign 0.35
R3835:Anapc7 UTSW 5 122443877 missense possibly damaging 0.83
R4963:Anapc7 UTSW 5 122422606 missense probably damaging 0.97
R5373:Anapc7 UTSW 5 122438217 missense probably benign 0.01
R5374:Anapc7 UTSW 5 122438217 missense probably benign 0.01
R5973:Anapc7 UTSW 5 122428303 missense probably benign
R7287:Anapc7 UTSW 5 122433436 missense probably benign 0.08
R8375:Anapc7 UTSW 5 122428279 missense probably benign 0.05
R8700:Anapc7 UTSW 5 122422606 missense probably damaging 0.97
R8744:Anapc7 UTSW 5 122428148 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGCATCCGAGAAGCAATG -3'
(R):5'- TCTGGACCAGACTAAACTAGTTC -3'

Sequencing Primer
(F):5'- GGTGATGGCCAACAATGTTTAC -3'
(R):5'- CCAAGTGGTGTTAGCTGGTTTAAAC -3'
Posted On2018-11-06