Mutagenetix > Incidental Mutations

Incidental Mutation 'R6911:Plxna1'

539020

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R6911 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89320974 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1774 (V1774A)

Ref Sequence

ENSEMBL: ENSMUSP00000131840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049845
AA Change: V1774A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: V1774A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163139
AA Change: V1774A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: V1774A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204468

Meta Mutation Damage Score

0.6800

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,268,353	I459N	probably damaging	Het
4930407I10Rik	T	A	15: 82,063,867	M655K	probably benign	Het
Amt	G	T	9: 108,301,229		probably null	Het
Anapc7	A	T	5: 122,440,280	K443*	probably null	Het
Apcs	A	G	1: 172,894,185	V198A	probably benign	Het
Atp2a1	A	G	7: 126,456,836	V271A	probably damaging	Het
Cdh20	T	C	1: 104,984,686	I555T	possibly damaging	Het
Cgnl1	T	C	9: 71,656,215	E810G	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,014	D101G	probably damaging	Het
Coq7	T	A	7: 118,510,162	H221L	unknown	Het
Depdc5	A	T	5: 32,924,192	Q566L	probably damaging	Het
Dync1i2	G	A	2: 71,247,102	V233I	probably benign	Het
Erp44	G	T	4: 48,204,268	H298N	probably benign	Het
Fam162a	A	G	16: 36,046,377		probably null	Het
Fancd2	A	G	6: 113,548,385	E274G	probably damaging	Het
Fkbp15	G	T	4: 62,340,290	Q147K	probably damaging	Het
Ganab	T	A	19: 8,907,788		probably null	Het
Gfm1	T	C	3: 67,451,303	V409A	possibly damaging	Het
Gm5346	A	T	8: 43,625,109	F693I	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid1	A	T	14: 34,820,228	M1L	probably benign	Het
Helz	C	T	11: 107,619,225	T558I	probably benign	Het
Htra4	A	G	8: 25,025,705	V439A	probably damaging	Het
Kctd17	A	G	15: 78,434,006	E95G	probably damaging	Het
Kif18b	T	C	11: 102,916,380	D43G	probably damaging	Het
Lrpprc	G	A	17: 84,756,283	S550L	possibly damaging	Het
Lrrfip1	T	A	1: 91,114,807	C311*	probably null	Het
Mcoln2	C	T	3: 146,192,256	T44I	probably damaging	Het
Med13l	A	G	5: 118,755,658	T2010A	possibly damaging	Het
Med23	C	T	10: 24,902,181	T803M	probably damaging	Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Myh13	C	T	11: 67,354,927	Q1095*	probably null	Het
Nktr	C	A	9: 121,754,326	Y93*	probably null	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Ntrk2	A	T	13: 58,859,215	E210D	probably damaging	Het
Nup210	G	T	6: 91,030,130	A568E	probably damaging	Het
Olfr1111	T	A	2: 87,149,767	K298I	probably damaging	Het
Olfr1279	A	G	2: 111,306,273	T23A	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr1393	A	G	11: 49,280,807	I220V	probably benign	Het
Pdlim5	T	C	3: 142,304,315	I289V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per1	C	T	11: 69,103,257	T443M	probably damaging	Het
Poteg	A	G	8: 27,450,298	Y165C	probably damaging	Het
Prlr	A	G	15: 10,329,184	T582A	probably benign	Het
Psma5	A	G	3: 108,265,148	E60G	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	T	C	13: 11,827,559	N484S	possibly damaging	Het
Sec31a	A	G	5: 100,393,264	I328T	possibly damaging	Het
Slc12a2	G	T	18: 57,919,469	V787L	probably benign	Het
St14	C	T	9: 31,106,785	R177Q	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tom1l1	G	T	11: 90,644,161		probably null	Het
Ttf1	A	G	2: 29,064,851	R76G	probably benign	Het
Ube4a	C	T	9: 44,942,758	E581K	probably damaging	Het
Vmn2r114	A	G	17: 23,291,130	V792A	probably damaging	Het
Wdr11	T	C	7: 129,607,095	I430T	probably benign	Het
Xkr4	T	C	1: 3,671,321	K10E	possibly damaging	Het
Zfp451	T	C	1: 33,803,456		probably benign	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R7960:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCATCTTGGCAATGTCAGC -3'
(R):5'- TCTAGCTGCTGTCCAGAAGG -3'

Sequencing Primer
(F):5'- CTTGGCAATGTCAGCATAGTACCTG -3'
(R):5'- CTGCTGTCCAGAAGGGGATG -3'

Posted On

2018-11-06