Incidental Mutation 'R6911:Coq7'
ID539023
Institutional Source Beutler Lab
Gene Symbol Coq7
Ensembl Gene ENSMUSG00000030652
Gene Namedemethyl-Q 7
Synonymsclk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118509659-118533356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118510162 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 221 (H221L)
Ref Sequence ENSEMBL: ENSMUSP00000095695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098090]
Predicted Effect unknown
Transcript: ENSMUST00000098090
AA Change: H221L
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652
AA Change: H221L

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for null mutations in this gene are embryonic lethal during mid-gestation with aborted neurogenesis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Coq7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Coq7 APN 7 118525304 missense probably damaging 0.98
R0309:Coq7 UTSW 7 118529717 missense possibly damaging 0.92
R0628:Coq7 UTSW 7 118529644 missense probably damaging 1.00
R1459:Coq7 UTSW 7 118510037 missense unknown
R1535:Coq7 UTSW 7 118529674 missense possibly damaging 0.48
R1612:Coq7 UTSW 7 118509911 missense unknown
R2519:Coq7 UTSW 7 118510148 missense unknown
R4095:Coq7 UTSW 7 118527478 critical splice acceptor site probably null
R4516:Coq7 UTSW 7 118509907 missense unknown
R4972:Coq7 UTSW 7 118510117 missense unknown
R5183:Coq7 UTSW 7 118528267 intron probably benign
R5579:Coq7 UTSW 7 118517335 missense unknown
R5619:Coq7 UTSW 7 118527486 splice site probably benign
R5789:Coq7 UTSW 7 118529706 missense possibly damaging 0.50
R6530:Coq7 UTSW 7 118525335 missense probably benign 0.01
R7212:Coq7 UTSW 7 118510048 missense unknown
R7248:Coq7 UTSW 7 118529674 missense probably benign 0.42
R7361:Coq7 UTSW 7 118529575 missense probably benign 0.15
R7781:Coq7 UTSW 7 118525888 missense probably damaging 1.00
R8039:Coq7 UTSW 7 118533246 missense possibly damaging 0.93
R8796:Coq7 UTSW 7 118527417 missense not run
RF001:Coq7 UTSW 7 118533182 missense probably benign 0.05
Z1177:Coq7 UTSW 7 118510149 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTGGGGCTTGTTCATCCC -3'
(R):5'- GTCTTCTGAGATAAGACTCCACTG -3'

Sequencing Primer
(F):5'- GAACAATCTTCAAAGCAGCTTCTGTC -3'
(R):5'- TCCATTATCATCAAGGTGGGAGC -3'
Posted On2018-11-06