Incidental Mutation 'R6911:Poteg'
ID539027
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27450298 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 165 (Y165C)
Ref Sequence ENSEMBL: ENSMUSP00000147760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081321
AA Change: Y169C

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: Y169C

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209669
AA Change: Y107C

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000210427
AA Change: Y165C

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCTATTGCTTGCTGGC -3'
(R):5'- CTCAAAGTTCGTGTGTCCGAG -3'

Sequencing Primer
(F):5'- ATCTTGAATTTCATGAGCTGACC -3'
(R):5'- AGTTCGTGTGTCCGAGCTCAC -3'
Posted On2018-11-06