Incidental Mutation 'R6911:Ube4a'
ID539030
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Nameubiquitination factor E4A
Synonyms9930123J21Rik, UFD2b, 4732444G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44923127-44965600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44942758 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 581 (E581K)
Ref Sequence ENSEMBL: ENSMUSP00000112632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287]
Predicted Effect probably damaging
Transcript: ENSMUST00000117506
AA Change: E562K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: E562K

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117549
AA Change: E581K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: E581K

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138559
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Meta Mutation Damage Score 0.1718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0863:Ube4a UTSW 9 44949816 missense possibly damaging 0.55
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R3758:Ube4a UTSW 9 44949900 unclassified probably benign
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4113:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4471:Ube4a UTSW 9 44946532 unclassified probably benign
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5641:Ube4a UTSW 9 44950881 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R7417:Ube4a UTSW 9 44956713 missense probably benign 0.08
R7650:Ube4a UTSW 9 44933436 missense probably damaging 0.99
R7747:Ube4a UTSW 9 44925973 missense probably damaging 1.00
R7798:Ube4a UTSW 9 44933331 missense probably damaging 1.00
R7842:Ube4a UTSW 9 44949727 splice site probably null
R7853:Ube4a UTSW 9 44953010 missense probably benign 0.43
R8109:Ube4a UTSW 9 44935483 missense probably benign 0.00
R8223:Ube4a UTSW 9 44960035 missense possibly damaging 0.94
R8401:Ube4a UTSW 9 44941229 missense possibly damaging 0.84
R8523:Ube4a UTSW 9 44949832 missense probably damaging 1.00
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTGTTTCCAAGGGACAGGC -3'
(R):5'- GTGGTCTATACTACACTGCCC -3'

Sequencing Primer
(F):5'- AGGCTGCTTACCTGGCACATAAG -3'
(R):5'- GTCTATACTACACTGCCCCCACATG -3'
Posted On2018-11-06