Incidental Mutation 'R6911:Cgnl1'
ID539031
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71656215 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 810 (E810G)
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072899
AA Change: E810G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: E810G

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121322
AA Change: E739G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: E739G

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122065
AA Change: E810G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: E810G

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 intron probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71725883 missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCAGGAAGGAGGGCTATAAGC -3'
(R):5'- GCCATGAGGTTACATCTCCAAC -3'

Sequencing Primer
(F):5'- AGCCAAGGCCCTCTTACCTC -3'
(R):5'- GGCTAGCCTGGAATTTTCAATC -3'
Posted On2018-11-06