Mutagenetix > Incidental Mutation

Incidental Mutation 'R6911:Med23'

539034

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

045003-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6911 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24902181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 803 (T803M)

Ref Sequence

ENSEMBL: ENSMUSP00000020159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020159
AA Change: T803M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: T803M

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092646
AA Change: T809M

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: T809M

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176285
AA Change: T443M

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: T443M

Domain	Start	End	E-Value	Type
Pfam:Med23	1	51	4.4e-14	PFAM
Pfam:Med23	48	950	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,268,353	I459N	probably damaging	Het
4930407I10Rik	T	A	15: 82,063,867	M655K	probably benign	Het
Amt	G	T	9: 108,301,229		probably null	Het
Anapc7	A	T	5: 122,440,280	K443*	probably null	Het
Apcs	A	G	1: 172,894,185	V198A	probably benign	Het
Atp2a1	A	G	7: 126,456,836	V271A	probably damaging	Het
Cdh20	T	C	1: 104,984,686	I555T	possibly damaging	Het
Cgnl1	T	C	9: 71,656,215	E810G	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,014	D101G	probably damaging	Het
Coq7	T	A	7: 118,510,162	H221L	unknown	Het
Depdc5	A	T	5: 32,924,192	Q566L	probably damaging	Het
Dync1i2	G	A	2: 71,247,102	V233I	probably benign	Het
Erp44	G	T	4: 48,204,268	H298N	probably benign	Het
Fam162a	A	G	16: 36,046,377		probably null	Het
Fancd2	A	G	6: 113,548,385	E274G	probably damaging	Het
Fkbp15	G	T	4: 62,340,290	Q147K	probably damaging	Het
Ganab	T	A	19: 8,907,788		probably null	Het
Gfm1	T	C	3: 67,451,303	V409A	possibly damaging	Het
Gm5346	A	T	8: 43,625,109	F693I	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid1	A	T	14: 34,820,228	M1L	probably benign	Het
Helz	C	T	11: 107,619,225	T558I	probably benign	Het
Htra4	A	G	8: 25,025,705	V439A	probably damaging	Het
Kctd17	A	G	15: 78,434,006	E95G	probably damaging	Het
Kif18b	T	C	11: 102,916,380	D43G	probably damaging	Het
Lrpprc	G	A	17: 84,756,283	S550L	possibly damaging	Het
Lrrfip1	T	A	1: 91,114,807	C311*	probably null	Het
Mcoln2	C	T	3: 146,192,256	T44I	probably damaging	Het
Med13l	A	G	5: 118,755,658	T2010A	possibly damaging	Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Myh13	C	T	11: 67,354,927	Q1095*	probably null	Het
Nktr	C	A	9: 121,754,326	Y93*	probably null	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Ntrk2	A	T	13: 58,859,215	E210D	probably damaging	Het
Nup210	G	T	6: 91,030,130	A568E	probably damaging	Het
Olfr1111	T	A	2: 87,149,767	K298I	probably damaging	Het
Olfr1279	A	G	2: 111,306,273	T23A	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr1393	A	G	11: 49,280,807	I220V	probably benign	Het
Pdlim5	T	C	3: 142,304,315	I289V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per1	C	T	11: 69,103,257	T443M	probably damaging	Het
Plxna1	A	G	6: 89,320,974	V1774A	probably damaging	Het
Poteg	A	G	8: 27,450,298	Y165C	probably damaging	Het
Prlr	A	G	15: 10,329,184	T582A	probably benign	Het
Psma5	A	G	3: 108,265,148	E60G	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	T	C	13: 11,827,559	N484S	possibly damaging	Het
Sec31a	A	G	5: 100,393,264	I328T	possibly damaging	Het
Slc12a2	G	T	18: 57,919,469	V787L	probably benign	Het
St14	C	T	9: 31,106,785	R177Q	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tom1l1	G	T	11: 90,644,161		probably null	Het
Ttf1	A	G	2: 29,064,851	R76G	probably benign	Het
Ube4a	C	T	9: 44,942,758	E581K	probably damaging	Het
Vmn2r114	A	G	17: 23,291,130	V792A	probably damaging	Het
Wdr11	T	C	7: 129,607,095	I430T	probably benign	Het
Xkr4	T	C	1: 3,671,321	K10E	possibly damaging	Het
Zfp451	T	C	1: 33,803,456		probably benign	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
R8975:Med23	UTSW	10	24904436	missense	probably benign	0.42
R9131:Med23	UTSW	10	24904381	missense
R9202:Med23	UTSW	10	24904304	missense	probably benign	0.12
R9341:Med23	UTSW	10	24912807	missense	probably benign
R9342:Med23	UTSW	10	24874571	missense	probably benign	0.01
R9343:Med23	UTSW	10	24912807	missense	probably benign
R9412:Med23	UTSW	10	24902121	missense	probably damaging	1.00
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAAATAACGTGCCCCAGG -3'
(R):5'- TCCACACCATGTCGTTGAG -3'

Sequencing Primer
(F):5'- CCCAGGAAAGCCGTTTTAATCTG -3'
(R):5'- TCCTGCTGACGTAGAGAACTC -3'

Posted On

2018-11-06