Incidental Mutation 'R6911:Myh13'
ID 539037
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, MyHC-eo, extraocular myosin
MMRRC Submission 045003-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R6911 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67217929-67262413 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 67245753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1095 (Q1095*)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably null
Transcript: ENSMUST00000081911
AA Change: Q1095*
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: Q1095*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108684
AA Change: Q1095*
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: Q1095*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180845
AA Change: Q1095*
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: Q1095*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 81,948,068 (GRCm39) M655K probably benign Het
Adam34l A T 8: 44,078,146 (GRCm39) F693I probably benign Het
Amt G T 9: 108,178,428 (GRCm39) probably null Het
Anapc7 A T 5: 122,578,343 (GRCm39) K443* probably null Het
Apcs A G 1: 172,721,752 (GRCm39) V198A probably benign Het
Atp2a1 A G 7: 126,056,008 (GRCm39) V271A probably damaging Het
Bltp2 T A 11: 78,159,179 (GRCm39) I459N probably damaging Het
Cdh20 T C 1: 104,912,411 (GRCm39) I555T possibly damaging Het
Cgnl1 T C 9: 71,563,497 (GRCm39) E810G possibly damaging Het
Cntnap5c A G 17: 58,199,009 (GRCm39) D101G probably damaging Het
Coq7 T A 7: 118,109,385 (GRCm39) H221L unknown Het
Depdc5 A T 5: 33,081,536 (GRCm39) Q566L probably damaging Het
Dync1i2 G A 2: 71,077,446 (GRCm39) V233I probably benign Het
Erp44 G T 4: 48,204,268 (GRCm39) H298N probably benign Het
Fam162a A G 16: 35,866,747 (GRCm39) probably null Het
Fancd2 A G 6: 113,525,346 (GRCm39) E274G probably damaging Het
Fkbp15 G T 4: 62,258,527 (GRCm39) Q147K probably damaging Het
Ganab T A 19: 8,885,152 (GRCm39) probably null Het
Gfm1 T C 3: 67,358,636 (GRCm39) V409A possibly damaging Het
Gnptab G A 10: 88,267,258 (GRCm39) G450S probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Grid1 A T 14: 34,542,185 (GRCm39) M1L probably benign Het
Helz C T 11: 107,510,051 (GRCm39) T558I probably benign Het
Htra4 A G 8: 25,515,721 (GRCm39) V439A probably damaging Het
Kctd17 A G 15: 78,318,206 (GRCm39) E95G probably damaging Het
Kif18b T C 11: 102,807,206 (GRCm39) D43G probably damaging Het
Lrpprc G A 17: 85,063,711 (GRCm39) S550L possibly damaging Het
Lrrfip1 T A 1: 91,042,529 (GRCm39) C311* probably null Het
Mcoln2 C T 3: 145,898,011 (GRCm39) T44I probably damaging Het
Med13l A G 5: 118,893,723 (GRCm39) T2010A possibly damaging Het
Med23 C T 10: 24,778,079 (GRCm39) T803M probably damaging Het
Mfsd13a T C 19: 46,357,716 (GRCm39) F290S probably damaging Het
Nktr C A 9: 121,583,392 (GRCm39) Y93* probably null Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Ntrk2 A T 13: 59,007,029 (GRCm39) E210D probably damaging Het
Nup210 G T 6: 91,007,112 (GRCm39) A568E probably damaging Het
Or10ak9 T A 4: 118,726,335 (GRCm39) M119K probably damaging Het
Or2y1g A G 11: 49,171,634 (GRCm39) I220V probably benign Het
Or4g16 A G 2: 111,136,618 (GRCm39) T23A probably benign Het
Or5as1 T A 2: 86,980,111 (GRCm39) K298I probably damaging Het
Pdlim5 T C 3: 142,010,076 (GRCm39) I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Per1 C T 11: 68,994,083 (GRCm39) T443M probably damaging Het
Plxna1 A G 6: 89,297,956 (GRCm39) V1774A probably damaging Het
Poteg A G 8: 27,940,326 (GRCm39) Y165C probably damaging Het
Prlr A G 15: 10,329,270 (GRCm39) T582A probably benign Het
Psma5 A G 3: 108,172,464 (GRCm39) E60G probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Ryr2 T C 13: 11,842,445 (GRCm39) N484S possibly damaging Het
Sec31a A G 5: 100,541,123 (GRCm39) I328T possibly damaging Het
Slc12a2 G T 18: 58,052,541 (GRCm39) V787L probably benign Het
St14 C T 9: 31,018,081 (GRCm39) R177Q probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tom1l1 G T 11: 90,534,987 (GRCm39) probably null Het
Ttf1 A G 2: 28,954,863 (GRCm39) R76G probably benign Het
Ube4a C T 9: 44,854,056 (GRCm39) E581K probably damaging Het
Vmn2r114 A G 17: 23,510,104 (GRCm39) V792A probably damaging Het
Wdr11 T C 7: 129,208,819 (GRCm39) I430T probably benign Het
Xkr4 T C 1: 3,741,544 (GRCm39) K10E possibly damaging Het
Zfp451 T C 1: 33,842,537 (GRCm39) probably benign Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67,233,314 (GRCm39) missense probably damaging 1.00
IGL00808:Myh13 APN 11 67,225,830 (GRCm39) critical splice donor site probably null
IGL00822:Myh13 APN 11 67,252,154 (GRCm39) missense probably damaging 0.98
IGL00823:Myh13 APN 11 67,246,773 (GRCm39) missense probably benign 0.00
IGL00945:Myh13 APN 11 67,238,832 (GRCm39) missense probably null 1.00
IGL01414:Myh13 APN 11 67,233,298 (GRCm39) missense probably benign 0.02
IGL01482:Myh13 APN 11 67,242,894 (GRCm39) missense probably benign
IGL01523:Myh13 APN 11 67,238,769 (GRCm39) missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67,260,045 (GRCm39) unclassified probably benign
IGL01997:Myh13 APN 11 67,257,992 (GRCm39) missense probably benign 0.14
IGL02369:Myh13 APN 11 67,251,100 (GRCm39) unclassified probably benign
IGL02478:Myh13 APN 11 67,260,204 (GRCm39) missense probably benign
IGL02663:Myh13 APN 11 67,245,753 (GRCm39) nonsense probably null
IGL02851:Myh13 APN 11 67,239,742 (GRCm39) missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67,223,367 (GRCm39) missense probably damaging 1.00
IGL02929:Myh13 APN 11 67,257,991 (GRCm39) missense probably damaging 1.00
IGL02979:Myh13 APN 11 67,225,788 (GRCm39) missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67,235,679 (GRCm39) missense probably damaging 0.99
IGL03214:Myh13 APN 11 67,244,411 (GRCm39) missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67,241,068 (GRCm39) missense probably benign 0.39
IGL03231:Myh13 APN 11 67,242,817 (GRCm39) missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67,242,978 (GRCm39) missense probably damaging 1.00
3-1:Myh13 UTSW 11 67,242,777 (GRCm39) splice site probably benign
P0042:Myh13 UTSW 11 67,225,817 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0379:Myh13 UTSW 11 67,260,121 (GRCm39) unclassified probably benign
R0496:Myh13 UTSW 11 67,239,641 (GRCm39) missense probably damaging 1.00
R0584:Myh13 UTSW 11 67,251,200 (GRCm39) nonsense probably null
R0595:Myh13 UTSW 11 67,235,672 (GRCm39) missense probably benign 0.03
R0621:Myh13 UTSW 11 67,232,058 (GRCm39) missense probably damaging 0.98
R0834:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67,225,427 (GRCm39) missense probably damaging 1.00
R0964:Myh13 UTSW 11 67,235,828 (GRCm39) missense probably benign 0.02
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0974:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R1028:Myh13 UTSW 11 67,247,007 (GRCm39) missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67,245,576 (GRCm39) missense probably damaging 1.00
R1283:Myh13 UTSW 11 67,261,747 (GRCm39) missense probably damaging 1.00
R1288:Myh13 UTSW 11 67,244,544 (GRCm39) missense probably benign 0.00
R1386:Myh13 UTSW 11 67,261,776 (GRCm39) missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67,221,872 (GRCm39) missense probably damaging 0.97
R1503:Myh13 UTSW 11 67,244,500 (GRCm39) missense probably benign 0.43
R1574:Myh13 UTSW 11 67,253,407 (GRCm39) unclassified probably benign
R1673:Myh13 UTSW 11 67,242,945 (GRCm39) missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67,232,310 (GRCm39) missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67,225,402 (GRCm39) missense probably benign
R2029:Myh13 UTSW 11 67,252,115 (GRCm39) missense probably benign 0.03
R2030:Myh13 UTSW 11 67,241,064 (GRCm39) missense probably benign
R2247:Myh13 UTSW 11 67,225,384 (GRCm39) missense probably damaging 0.96
R2393:Myh13 UTSW 11 67,231,184 (GRCm39) missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67,255,748 (GRCm39) missense probably benign 0.12
R2884:Myh13 UTSW 11 67,228,469 (GRCm39) missense probably benign 0.27
R3696:Myh13 UTSW 11 67,235,870 (GRCm39) missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67,218,014 (GRCm39) missense probably benign 0.01
R3875:Myh13 UTSW 11 67,249,020 (GRCm39) missense probably benign 0.26
R3918:Myh13 UTSW 11 67,220,064 (GRCm39) missense probably benign 0.00
R4061:Myh13 UTSW 11 67,221,715 (GRCm39) missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67,255,636 (GRCm39) intron probably benign
R4183:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67,235,707 (GRCm39) splice site probably null
R4639:Myh13 UTSW 11 67,232,377 (GRCm39) missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67,255,564 (GRCm39) nonsense probably null
R4783:Myh13 UTSW 11 67,232,096 (GRCm39) missense probably damaging 1.00
R4877:Myh13 UTSW 11 67,228,477 (GRCm39) missense probably damaging 0.99
R5250:Myh13 UTSW 11 67,218,085 (GRCm39) nonsense probably null
R5278:Myh13 UTSW 11 67,225,390 (GRCm39) missense probably benign 0.00
R5371:Myh13 UTSW 11 67,235,616 (GRCm39) splice site probably null
R5479:Myh13 UTSW 11 67,239,648 (GRCm39) missense probably damaging 0.97
R5510:Myh13 UTSW 11 67,228,549 (GRCm39) missense probably benign 0.05
R5690:Myh13 UTSW 11 67,220,101 (GRCm39) missense probably damaging 1.00
R5797:Myh13 UTSW 11 67,225,828 (GRCm39) missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R5877:Myh13 UTSW 11 67,244,484 (GRCm39) missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67,255,556 (GRCm39) missense probably damaging 1.00
R6175:Myh13 UTSW 11 67,245,588 (GRCm39) missense probably benign 0.00
R6244:Myh13 UTSW 11 67,253,327 (GRCm39) missense probably benign 0.00
R6454:Myh13 UTSW 11 67,241,191 (GRCm39) missense probably benign 0.03
R6617:Myh13 UTSW 11 67,252,226 (GRCm39) missense probably benign 0.00
R6707:Myh13 UTSW 11 67,241,086 (GRCm39) missense probably damaging 1.00
R6747:Myh13 UTSW 11 67,241,245 (GRCm39) missense probably damaging 0.99
R6823:Myh13 UTSW 11 67,246,984 (GRCm39) missense probably benign
R6997:Myh13 UTSW 11 67,217,980 (GRCm39) nonsense probably null
R7033:Myh13 UTSW 11 67,260,142 (GRCm39) missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67,245,566 (GRCm39) missense probably benign 0.08
R7232:Myh13 UTSW 11 67,239,672 (GRCm39) missense probably damaging 1.00
R7428:Myh13 UTSW 11 67,223,390 (GRCm39) missense probably damaging 1.00
R7448:Myh13 UTSW 11 67,255,286 (GRCm39) critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67,258,537 (GRCm39) missense
R7474:Myh13 UTSW 11 67,217,990 (GRCm39) missense possibly damaging 0.93
R7766:Myh13 UTSW 11 67,249,155 (GRCm39) missense probably benign 0.37
R7809:Myh13 UTSW 11 67,241,167 (GRCm39) missense probably benign 0.14
R7813:Myh13 UTSW 11 67,218,056 (GRCm39) missense probably benign 0.27
R7953:Myh13 UTSW 11 67,231,206 (GRCm39) missense probably damaging 1.00
R8085:Myh13 UTSW 11 67,225,613 (GRCm39) missense probably benign 0.00
R8397:Myh13 UTSW 11 67,241,113 (GRCm39) missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67,254,011 (GRCm39) critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67,255,351 (GRCm39) missense probably damaging 0.98
R8676:Myh13 UTSW 11 67,233,311 (GRCm39) missense probably damaging 1.00
R8681:Myh13 UTSW 11 67,242,960 (GRCm39) missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67,255,432 (GRCm39) missense probably benign 0.00
R9088:Myh13 UTSW 11 67,242,885 (GRCm39) missense probably damaging 1.00
R9151:Myh13 UTSW 11 67,252,149 (GRCm39) missense probably damaging 1.00
R9154:Myh13 UTSW 11 67,253,318 (GRCm39) missense probably benign
R9182:Myh13 UTSW 11 67,228,579 (GRCm39) missense probably damaging 1.00
R9332:Myh13 UTSW 11 67,254,109 (GRCm39) missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67,242,894 (GRCm39) missense probably benign
R9446:Myh13 UTSW 11 67,255,325 (GRCm39) missense probably benign 0.01
R9474:Myh13 UTSW 11 67,255,712 (GRCm39) missense
R9690:Myh13 UTSW 11 67,249,194 (GRCm39) missense probably damaging 1.00
R9761:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R9778:Myh13 UTSW 11 67,249,016 (GRCm39) missense probably damaging 0.98
Z1176:Myh13 UTSW 11 67,220,121 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,255,417 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,241,278 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGAAGATGTCCCAGGAATCC -3'
(R):5'- AAAACTGATGTGCTGCTGAAG -3'

Sequencing Primer
(F):5'- TGAAGATGTCCCAGGAATCCATCATG -3'
(R):5'- GCTGAAGCAGAGAGGAGAAAG -3'
Posted On 2018-11-06