Incidental Mutation 'R6911:Per1'
ID539038
Institutional Source Beutler Lab
Gene Symbol Per1
Ensembl Gene ENSMUSG00000020893
Gene Nameperiod circadian clock 1
SynonymsmPer1, m-rigui
MMRRC Submission
Accession Numbers

Genbank: NM_011065; MGI:1098283

Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69095217-69109960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69103257 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 443 (T443M)
Ref Sequence ENSEMBL: ENSMUSP00000099665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021271] [ENSMUST00000101004] [ENSMUST00000102605] [ENSMUST00000132462] [ENSMUST00000142392] [ENSMUST00000166748]
Predicted Effect probably benign
Transcript: ENSMUST00000021271
AA Change: T463M

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021271
Gene: ENSMUSG00000020893
AA Change: T463M

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1222 1.5e-78 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101004
AA Change: T463M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098566
Gene: ENSMUSG00000020893
AA Change: T463M

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102605
AA Change: T443M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099665
Gene: ENSMUSG00000020893
AA Change: T443M

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Blast:PAS 203 255 1e-23 BLAST
PAS 328 394 1.12e-4 SMART
PAC 402 445 1.6e0 SMART
low complexity region 453 461 N/A INTRINSIC
low complexity region 493 523 N/A INTRINSIC
low complexity region 551 558 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 727 752 N/A INTRINSIC
low complexity region 774 788 N/A INTRINSIC
low complexity region 797 824 N/A INTRINSIC
low complexity region 832 857 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
low complexity region 925 952 N/A INTRINSIC
low complexity region 976 993 N/A INTRINSIC
Pfam:Period_C 1011 1210 7.5e-75 PFAM
low complexity region 1250 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132462
SMART Domains Protein: ENSMUSP00000122164
Gene: ENSMUSG00000020893

DomainStartEndE-ValueType
low complexity region 48 81 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142392
AA Change: T463M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121713
Gene: ENSMUSG00000020893
AA Change: T463M

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166748
AA Change: T463M

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132635
Gene: ENSMUSG00000020893
AA Change: T463M

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1230 5.2e-75 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display a persistent circadian rhythm, but they have a shorter period and their ability to maintain the precision and the stability of the period is impaired. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(3) Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Per1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Per1 APN 11 69104199 missense probably damaging 1.00
IGL01907:Per1 APN 11 69105599 missense probably benign 0.00
IGL02078:Per1 APN 11 69104299 missense probably damaging 1.00
IGL02296:Per1 APN 11 69102175 missense probably damaging 1.00
IGL02677:Per1 APN 11 69106660 missense probably benign 0.07
0152:Per1 UTSW 11 69104022 splice site probably benign
IGL03048:Per1 UTSW 11 69104726 missense probably damaging 0.99
P0043:Per1 UTSW 11 69102043 splice site probably benign
R0089:Per1 UTSW 11 69104043 missense probably benign 0.27
R0116:Per1 UTSW 11 69101880 splice site probably benign
R0395:Per1 UTSW 11 69102277 missense probably damaging 1.00
R0531:Per1 UTSW 11 69104190 missense probably damaging 1.00
R0681:Per1 UTSW 11 69101201 missense probably damaging 1.00
R0788:Per1 UTSW 11 69101359 splice site probably benign
R1233:Per1 UTSW 11 69102211 missense probably damaging 1.00
R1554:Per1 UTSW 11 69103627 missense probably damaging 1.00
R3793:Per1 UTSW 11 69109301 missense probably benign 0.30
R4706:Per1 UTSW 11 69100618 start gained probably benign
R4716:Per1 UTSW 11 69101231 missense probably damaging 1.00
R4965:Per1 UTSW 11 69104401 missense probably benign 0.06
R5111:Per1 UTSW 11 69100786 missense probably damaging 1.00
R5270:Per1 UTSW 11 69103598 missense probably benign
R5583:Per1 UTSW 11 69103445 missense probably damaging 1.00
R5588:Per1 UTSW 11 69107627 missense probably damaging 1.00
R6184:Per1 UTSW 11 69102904 missense probably damaging 1.00
R6430:Per1 UTSW 11 69104296 missense probably damaging 1.00
R6819:Per1 UTSW 11 69101458 missense probably damaging 1.00
R7158:Per1 UTSW 11 69104104 unclassified probably benign
R7340:Per1 UTSW 11 69103182 missense probably damaging 1.00
R7438:Per1 UTSW 11 69104735 missense possibly damaging 0.79
R7513:Per1 UTSW 11 69105571 missense probably benign 0.00
R7555:Per1 UTSW 11 69106513 missense probably damaging 1.00
R7921:Per1 UTSW 11 69100779 missense probably damaging 1.00
R8059:Per1 UTSW 11 69106483 missense probably damaging 1.00
R8345:Per1 UTSW 11 69107556 missense possibly damaging 0.63
R8408:Per1 UTSW 11 69109127 missense possibly damaging 0.86
X0023:Per1 UTSW 11 69103124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCGTGGTCTCTTGGATATC -3'
(R):5'- TCCTGGATATCAGAGTCCAGGG -3'

Sequencing Primer
(F):5'- GGCTCTCCCATTCACTGATAC -3'
(R):5'- TCCAGGGACGGAGCTGG -3'
Posted On2018-11-06