Incidental Mutation 'R6911:Kif18b'
ID539040
Institutional Source Beutler Lab
Gene Symbol Kif18b
Ensembl Gene ENSMUSG00000051378
Gene Namekinesin family member 18B
Synonyms3000004C01Rik, N-8 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102905529-102925124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102916380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 43 (D43G)
Ref Sequence ENSEMBL: ENSMUSP00000021311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021311]
Predicted Effect probably damaging
Transcript: ENSMUST00000021311
AA Change: D43G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021311
Gene: ENSMUSG00000051378
AA Change: D43G

DomainStartEndE-ValueType
KISc 7 361 1.47e-158 SMART
coiled coil region 368 404 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Kif18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Kif18b APN 11 102914675 missense probably damaging 0.99
IGL01570:Kif18b APN 11 102912391 missense probably benign 0.04
IGL02965:Kif18b APN 11 102916512 start gained probably benign
IGL02997:Kif18b APN 11 102909084 missense probably damaging 1.00
IGL03135:Kif18b APN 11 102914260 missense probably damaging 1.00
IGL02988:Kif18b UTSW 11 102908320 missense probably damaging 1.00
R0541:Kif18b UTSW 11 102915175 missense probably damaging 0.98
R1446:Kif18b UTSW 11 102914699 missense probably damaging 0.99
R1674:Kif18b UTSW 11 102913060 missense probably benign 0.04
R1729:Kif18b UTSW 11 102915541 critical splice donor site probably null
R1784:Kif18b UTSW 11 102915541 critical splice donor site probably null
R2249:Kif18b UTSW 11 102912388 missense probably benign 0.01
R2291:Kif18b UTSW 11 102908270 missense probably damaging 1.00
R3723:Kif18b UTSW 11 102916276 missense probably damaging 1.00
R5496:Kif18b UTSW 11 102913742 missense possibly damaging 0.88
R5500:Kif18b UTSW 11 102915700 missense probably damaging 1.00
R5598:Kif18b UTSW 11 102908189 missense possibly damaging 0.89
R5820:Kif18b UTSW 11 102913048 missense probably benign 0.00
R5910:Kif18b UTSW 11 102913544 missense probably benign
R5912:Kif18b UTSW 11 102912991 missense probably benign
R6394:Kif18b UTSW 11 102914410 missense probably damaging 1.00
R6541:Kif18b UTSW 11 102914266 missense probably damaging 1.00
R7467:Kif18b UTSW 11 102916408 missense probably damaging 1.00
R7467:Kif18b UTSW 11 102912348 splice site probably null
R7526:Kif18b UTSW 11 102914667 missense probably damaging 1.00
R7581:Kif18b UTSW 11 102914722 missense probably damaging 1.00
R8314:Kif18b UTSW 11 102913074 missense probably benign
R8378:Kif18b UTSW 11 102916473 missense probably damaging 1.00
RF013:Kif18b UTSW 11 102912366 missense probably benign 0.00
Z1088:Kif18b UTSW 11 102908157 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCACCTGAGCAGTTGTAGC -3'
(R):5'- TGGAAGGAAGGCCATTTGATAC -3'

Sequencing Primer
(F):5'- TGTAGCCCTGGAGAAAGCTGTC -3'
(R):5'- GGCCATTTGATACTGAAGCATACAC -3'
Posted On2018-11-06