Incidental Mutation 'R6911:Prlr'
ID539046
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Nameprolactin receptor
SynonymsPrlr-rs1, Pr-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10177238-10349180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10329184 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 582 (T582A)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: T582A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: T582A

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10328324 missense probably benign 0.00
IGL00688:Prlr APN 15 10322381 unclassified probably benign
IGL01527:Prlr APN 15 10329171 missense probably benign 0.28
IGL01626:Prlr APN 15 10328718 missense probably benign 0.12
IGL01660:Prlr APN 15 10317590 missense probably damaging 1.00
IGL01835:Prlr APN 15 10329043 missense probably damaging 1.00
IGL01926:Prlr APN 15 10314220 start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10328342 missense possibly damaging 0.95
IGL02306:Prlr APN 15 10328674 missense probably benign 0.05
IGL02394:Prlr APN 15 10328578 missense probably benign 0.03
IGL02430:Prlr APN 15 10325391 missense probably damaging 1.00
IGL02695:Prlr APN 15 10328365 missense probably benign 0.20
IGL02745:Prlr APN 15 10328594 missense possibly damaging 0.50
IGL03193:Prlr APN 15 10328290 missense possibly damaging 0.57
IGL03277:Prlr APN 15 10328801 missense probably benign 0.01
IGL03379:Prlr APN 15 10319317 missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10328372 missense probably damaging 1.00
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0545:Prlr UTSW 15 10317566 missense probably damaging 1.00
R1236:Prlr UTSW 15 10325281 missense probably benign 0.13
R1352:Prlr UTSW 15 10328786 missense probably benign
R1524:Prlr UTSW 15 10319333 missense probably damaging 0.97
R1537:Prlr UTSW 15 10328278 splice site probably null
R1690:Prlr UTSW 15 10317590 missense probably damaging 1.00
R1773:Prlr UTSW 15 10325318 nonsense probably null
R1789:Prlr UTSW 15 10322536 missense probably benign 0.32
R2421:Prlr UTSW 15 10319257 missense probably damaging 1.00
R4518:Prlr UTSW 15 10328999 missense possibly damaging 0.53
R4621:Prlr UTSW 15 10319376 intron probably benign
R4855:Prlr UTSW 15 10328797 missense probably benign 0.01
R4957:Prlr UTSW 15 10319195 missense probably damaging 1.00
R5053:Prlr UTSW 15 10325385 missense probably benign 0.00
R5731:Prlr UTSW 15 10314135 missense probably benign 0.00
R5749:Prlr UTSW 15 10328718 missense probably benign 0.12
R5806:Prlr UTSW 15 10319204 missense probably damaging 1.00
R5927:Prlr UTSW 15 10322446 missense probably benign 0.42
R6170:Prlr UTSW 15 10328849 missense probably benign 0.05
R6935:Prlr UTSW 15 10319302 missense probably damaging 1.00
R7327:Prlr UTSW 15 10346438 missense probably benign 0.00
R7539:Prlr UTSW 15 10329023 missense probably benign 0.11
R7579:Prlr UTSW 15 10328935 missense probably benign 0.08
R7615:Prlr UTSW 15 10325924 missense probably damaging 1.00
R7651:Prlr UTSW 15 10328378 missense probably benign 0.26
R8213:Prlr UTSW 15 10329242 missense possibly damaging 0.95
Z1176:Prlr UTSW 15 10314255 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTACTCCCCAAGCAGAGAG -3'
(R):5'- CACATCCTGTAACATCTGTTAGC -3'

Sequencing Primer
(F):5'- CCAGACAGAAAACCCTGGGG -3'
(R):5'- GTTAGCAGACCACATTACTTCATGAC -3'
Posted On2018-11-06