Incidental Mutation 'R6911:Kctd17'
ID539047
Institutional Source Beutler Lab
Gene Symbol Kctd17
Ensembl Gene ENSMUSG00000033287
Gene Namepotassium channel tetramerisation domain containing 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78428564-78439303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78434006 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 95 (E95G)
Ref Sequence ENSEMBL: ENSMUSP00000155227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089414] [ENSMUST00000159771] [ENSMUST00000162517] [ENSMUST00000162321] [ENSMUST00000166142] [ENSMUST00000229290] [ENSMUST00000229622]
Predicted Effect probably damaging
Transcript: ENSMUST00000089414
AA Change: E168G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086835
Gene: ENSMUSG00000033287
AA Change: E168G

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
coiled coil region 208 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159771
AA Change: E161G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125574
Gene: ENSMUSG00000033287
AA Change: E161G

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
BTB 24 125 1.76e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162517
AA Change: E168G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124290
Gene: ENSMUSG00000033287
AA Change: E168G

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
low complexity region 227 235 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162321
AA Change: E122G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125680
Gene: ENSMUSG00000033287
AA Change: E122G

DomainStartEndE-ValueType
BTB 3 86 9.93e-2 SMART
low complexity region 168 195 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000125421
Gene: ENSMUSG00000033287
AA Change: E83G

DomainStartEndE-ValueType
SCOP:d3kvt__ 2 36 3e-8 SMART
Blast:BTB 2 98 6e-30 BLAST
PDB:3DRY|E 2 127 4e-69 PDB
low complexity region 130 157 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166142
AA Change: E168G

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133210
Gene: ENSMUSG00000033287
AA Change: E168G

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
BTB 31 132 1.76e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229290
AA Change: E66G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000229622
AA Change: E95G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6288 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrpprc G A 17: 84,756,283 S550L possibly damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Kctd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Kctd17 APN 15 78430156 splice site probably benign
IGL02209:Kctd17 APN 15 78435592 missense probably damaging 1.00
IGL03132:Kctd17 APN 15 78435687 missense probably damaging 1.00
R4676:Kctd17 UTSW 15 78435759 unclassified probably benign
R4793:Kctd17 UTSW 15 78433024 missense probably damaging 1.00
R5428:Kctd17 UTSW 15 78428782 missense probably damaging 1.00
R5590:Kctd17 UTSW 15 78437302 unclassified probably benign
R5779:Kctd17 UTSW 15 78437133 unclassified probably benign
R6249:Kctd17 UTSW 15 78430039 splice site probably null
R7266:Kctd17 UTSW 15 78433014 missense probably damaging 1.00
R7324:Kctd17 UTSW 15 78435642 missense probably damaging 1.00
R7706:Kctd17 UTSW 15 78436913 unclassified probably benign
R7707:Kctd17 UTSW 15 78436913 unclassified probably benign
R7967:Kctd17 UTSW 15 78436913 unclassified probably benign
R7968:Kctd17 UTSW 15 78436913 unclassified probably benign
R7970:Kctd17 UTSW 15 78436913 unclassified probably benign
R7972:Kctd17 UTSW 15 78436913 unclassified probably benign
R7973:Kctd17 UTSW 15 78436913 unclassified probably benign
R8097:Kctd17 UTSW 15 78436913 unclassified probably benign
R8098:Kctd17 UTSW 15 78436913 unclassified probably benign
R8099:Kctd17 UTSW 15 78436913 unclassified probably benign
R8100:Kctd17 UTSW 15 78436913 unclassified probably benign
R8333:Kctd17 UTSW 15 78436913 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCTATGTTATGGGCTGG -3'
(R):5'- GATCTCCTACACCTGAGCTGTC -3'

Sequencing Primer
(F):5'- CCTCTATGTTATGGGCTGGGGAAG -3'
(R):5'- TACACCTGAGCTGTCCCTGAG -3'
Posted On2018-11-06