Mutagenetix > Incidental Mutations

Incidental Mutation 'R6911:Nox3'

539050

Institutional Source

Beutler Lab

Gene Symbol

Nox3

Ensembl Gene

ENSMUSG00000023802

Gene Name

NADPH oxidase 3

Synonyms

nmf250, het

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.340) question?

Stock #

R6911 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3635240-3696261 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3685923 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 143 (S143P)

Ref Sequence

ENSEMBL: ENSMUSP00000111466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115800]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115800
AA Change: S143P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: S143P

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Ferric_reduct	55	218	5.4e-23	PFAM
Pfam:FAD_binding_6	290	379	1.8e-8	PFAM
Pfam:FAD_binding_8	291	393	1.5e-27	PFAM
Pfam:NAD_binding_6	399	549	1e-34	PFAM

Meta Mutation Damage Score

0.4403

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,268,353	I459N	probably damaging	Het
4930407I10Rik	T	A	15: 82,063,867	M655K	probably benign	Het
Amt	G	T	9: 108,301,229		probably null	Het
Anapc7	A	T	5: 122,440,280	K443*	probably null	Het
Apcs	A	G	1: 172,894,185	V198A	probably benign	Het
Atp2a1	A	G	7: 126,456,836	V271A	probably damaging	Het
Cdh20	T	C	1: 104,984,686	I555T	possibly damaging	Het
Cgnl1	T	C	9: 71,656,215	E810G	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,014	D101G	probably damaging	Het
Coq7	T	A	7: 118,510,162	H221L	unknown	Het
Depdc5	A	T	5: 32,924,192	Q566L	probably damaging	Het
Dync1i2	G	A	2: 71,247,102	V233I	probably benign	Het
Erp44	G	T	4: 48,204,268	H298N	probably benign	Het
Fam162a	A	G	16: 36,046,377		probably null	Het
Fancd2	A	G	6: 113,548,385	E274G	probably damaging	Het
Fkbp15	G	T	4: 62,340,290	Q147K	probably damaging	Het
Ganab	T	A	19: 8,907,788		probably null	Het
Gfm1	T	C	3: 67,451,303	V409A	possibly damaging	Het
Gm5346	A	T	8: 43,625,109	F693I	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid1	A	T	14: 34,820,228	M1L	probably benign	Het
Helz	C	T	11: 107,619,225	T558I	probably benign	Het
Htra4	A	G	8: 25,025,705	V439A	probably damaging	Het
Kctd17	A	G	15: 78,434,006	E95G	probably damaging	Het
Kif18b	T	C	11: 102,916,380	D43G	probably damaging	Het
Lrpprc	G	A	17: 84,756,283	S550L	possibly damaging	Het
Lrrfip1	T	A	1: 91,114,807	C311*	probably null	Het
Mcoln2	C	T	3: 146,192,256	T44I	probably damaging	Het
Med13l	A	G	5: 118,755,658	T2010A	possibly damaging	Het
Med23	C	T	10: 24,902,181	T803M	probably damaging	Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Myh13	C	T	11: 67,354,927	Q1095*	probably null	Het
Nktr	C	A	9: 121,754,326	Y93*	probably null	Het
Ntrk2	A	T	13: 58,859,215	E210D	probably damaging	Het
Nup210	G	T	6: 91,030,130	A568E	probably damaging	Het
Olfr1111	T	A	2: 87,149,767	K298I	probably damaging	Het
Olfr1279	A	G	2: 111,306,273	T23A	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr1393	A	G	11: 49,280,807	I220V	probably benign	Het
Pdlim5	T	C	3: 142,304,315	I289V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per1	C	T	11: 69,103,257	T443M	probably damaging	Het
Plxna1	A	G	6: 89,320,974	V1774A	probably damaging	Het
Poteg	A	G	8: 27,450,298	Y165C	probably damaging	Het
Prlr	A	G	15: 10,329,184	T582A	probably benign	Het
Psma5	A	G	3: 108,265,148	E60G	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	T	C	13: 11,827,559	N484S	possibly damaging	Het
Sec31a	A	G	5: 100,393,264	I328T	possibly damaging	Het
Slc12a2	G	T	18: 57,919,469	V787L	probably benign	Het
St14	C	T	9: 31,106,785	R177Q	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tom1l1	G	T	11: 90,644,161		probably null	Het
Ttf1	A	G	2: 29,064,851	R76G	probably benign	Het
Ube4a	C	T	9: 44,942,758	E581K	probably damaging	Het
Vmn2r114	A	G	17: 23,291,130	V792A	probably damaging	Het
Wdr11	T	C	7: 129,607,095	I430T	probably benign	Het
Xkr4	T	C	1: 3,671,321	K10E	possibly damaging	Het
Zfp451	T	C	1: 33,803,456		probably benign	Het

Other mutations in Nox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Nox3	APN	17	3683015	missense	probably damaging	0.99
IGL01135:Nox3	APN	17	3696252	utr 5 prime	probably benign
IGL01791:Nox3	APN	17	3682943	missense	possibly damaging	0.68
IGL02423:Nox3	APN	17	3682916	missense	probably damaging	1.00
IGL03091:Nox3	APN	17	3665844	missense	probably benign	0.42
R0046:Nox3	UTSW	17	3682961	missense	probably benign	0.08
R0046:Nox3	UTSW	17	3682961	missense	probably benign	0.08
R0085:Nox3	UTSW	17	3635281	missense	probably benign	0.14
R0426:Nox3	UTSW	17	3695563	missense	probably damaging	1.00
R0690:Nox3	UTSW	17	3695564	missense	probably damaging	1.00
R1281:Nox3	UTSW	17	3696185	missense	probably damaging	1.00
R1350:Nox3	UTSW	17	3650121	missense	probably damaging	1.00
R1843:Nox3	UTSW	17	3669878	missense	probably damaging	1.00
R1902:Nox3	UTSW	17	3670017	missense	probably damaging	1.00
R2023:Nox3	UTSW	17	3694021	splice site	probably benign
R2762:Nox3	UTSW	17	3696158	missense	probably benign	0.35
R2872:Nox3	UTSW	17	3682916	missense	probably damaging	1.00
R2872:Nox3	UTSW	17	3682916	missense	probably damaging	1.00
R4429:Nox3	UTSW	17	3682958	missense	probably benign	0.05
R4630:Nox3	UTSW	17	3693982	missense	possibly damaging	0.53
R4926:Nox3	UTSW	17	3669894	missense	probably damaging	1.00
R4928:Nox3	UTSW	17	3635275	missense	probably null	1.00
R5181:Nox3	UTSW	17	3635286	nonsense	probably null
R6912:Nox3	UTSW	17	3685923	missense	probably damaging	1.00
R7486:Nox3	UTSW	17	3669944	missense	probably damaging	1.00
R7529:Nox3	UTSW	17	3671775	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCAGAAACCTCTTTTATCCAGC -3'
(R):5'- CATTCAAGACACTGGGAGAGATGC -3'

Sequencing Primer
(F):5'- TTATCCAGCTCTTTTATGTGAAGC -3'
(R):5'- AATTCCTTGTAGACTGCCAGAGC -3'

Posted On

2018-11-06