Incidental Mutation 'R6911:Lrpprc'
ID539053
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Nameleucine-rich PPR-motif containing
Synonyms3110001K13Rik, Lrp130
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6911 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84705247-84790789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84756283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 550 (S550L)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: S550L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: S550L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (60/61)
MGI Phenotype Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,268,353 I459N probably damaging Het
4930407I10Rik T A 15: 82,063,867 M655K probably benign Het
Amt G T 9: 108,301,229 probably null Het
Anapc7 A T 5: 122,440,280 K443* probably null Het
Apcs A G 1: 172,894,185 V198A probably benign Het
Atp2a1 A G 7: 126,456,836 V271A probably damaging Het
Cdh20 T C 1: 104,984,686 I555T possibly damaging Het
Cgnl1 T C 9: 71,656,215 E810G possibly damaging Het
Cntnap5c A G 17: 57,892,014 D101G probably damaging Het
Coq7 T A 7: 118,510,162 H221L unknown Het
Depdc5 A T 5: 32,924,192 Q566L probably damaging Het
Dync1i2 G A 2: 71,247,102 V233I probably benign Het
Erp44 G T 4: 48,204,268 H298N probably benign Het
Fam162a A G 16: 36,046,377 probably null Het
Fancd2 A G 6: 113,548,385 E274G probably damaging Het
Fkbp15 G T 4: 62,340,290 Q147K probably damaging Het
Ganab T A 19: 8,907,788 probably null Het
Gfm1 T C 3: 67,451,303 V409A possibly damaging Het
Gm5346 A T 8: 43,625,109 F693I probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid1 A T 14: 34,820,228 M1L probably benign Het
Helz C T 11: 107,619,225 T558I probably benign Het
Htra4 A G 8: 25,025,705 V439A probably damaging Het
Kctd17 A G 15: 78,434,006 E95G probably damaging Het
Kif18b T C 11: 102,916,380 D43G probably damaging Het
Lrrfip1 T A 1: 91,114,807 C311* probably null Het
Mcoln2 C T 3: 146,192,256 T44I probably damaging Het
Med13l A G 5: 118,755,658 T2010A possibly damaging Het
Med23 C T 10: 24,902,181 T803M probably damaging Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Myh13 C T 11: 67,354,927 Q1095* probably null Het
Nktr C A 9: 121,754,326 Y93* probably null Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Ntrk2 A T 13: 58,859,215 E210D probably damaging Het
Nup210 G T 6: 91,030,130 A568E probably damaging Het
Olfr1111 T A 2: 87,149,767 K298I probably damaging Het
Olfr1279 A G 2: 111,306,273 T23A probably benign Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr1393 A G 11: 49,280,807 I220V probably benign Het
Pdlim5 T C 3: 142,304,315 I289V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per1 C T 11: 69,103,257 T443M probably damaging Het
Plxna1 A G 6: 89,320,974 V1774A probably damaging Het
Poteg A G 8: 27,450,298 Y165C probably damaging Het
Prlr A G 15: 10,329,184 T582A probably benign Het
Psma5 A G 3: 108,265,148 E60G probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 T C 13: 11,827,559 N484S possibly damaging Het
Sec31a A G 5: 100,393,264 I328T possibly damaging Het
Slc12a2 G T 18: 57,919,469 V787L probably benign Het
St14 C T 9: 31,106,785 R177Q probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tom1l1 G T 11: 90,644,161 probably null Het
Ttf1 A G 2: 29,064,851 R76G probably benign Het
Ube4a C T 9: 44,942,758 E581K probably damaging Het
Vmn2r114 A G 17: 23,291,130 V792A probably damaging Het
Wdr11 T C 7: 129,607,095 I430T probably benign Het
Xkr4 T C 1: 3,671,321 K10E possibly damaging Het
Zfp451 T C 1: 33,803,456 probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 84750525 missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 84705412 utr 3 prime probably benign
IGL01380:Lrpprc APN 17 84722730 missense probably benign
IGL01560:Lrpprc APN 17 84708119 missense probably benign 0.07
IGL01582:Lrpprc APN 17 84754543 missense probably null 0.00
IGL01996:Lrpprc APN 17 84773270 missense probably benign
IGL02109:Lrpprc APN 17 84726570 nonsense probably null
IGL02163:Lrpprc APN 17 84753472 missense probably damaging 0.97
IGL02248:Lrpprc APN 17 84771467 missense probably damaging 0.99
IGL02503:Lrpprc APN 17 84726339 missense probably benign
IGL02545:Lrpprc APN 17 84775425 missense probably benign
IGL02570:Lrpprc APN 17 84750553 missense probably damaging 1.00
IGL02636:Lrpprc APN 17 84753104 unclassified probably benign
IGL02943:Lrpprc APN 17 84771450 missense probably benign 0.00
IGL03008:Lrpprc APN 17 84751247 missense probably benign 0.05
R6807_Lrpprc_629 UTSW 17 84749103 missense possibly damaging 0.93
P0023:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0302:Lrpprc UTSW 17 84740078 missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 84753112 critical splice donor site probably null
R0448:Lrpprc UTSW 17 84770894 missense probably benign 0.09
R1396:Lrpprc UTSW 17 84726303 missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 84740081 missense probably damaging 1.00
R2019:Lrpprc UTSW 17 84752331 missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 84770077 missense probably benign 0.00
R2312:Lrpprc UTSW 17 84773258 missense probably damaging 0.96
R2319:Lrpprc UTSW 17 84726390 missense probably benign
R2568:Lrpprc UTSW 17 84726649 missense probably damaging 1.00
R3013:Lrpprc UTSW 17 84767069 missense probably benign 0.04
R3620:Lrpprc UTSW 17 84770024 missense probably benign 0.01
R3789:Lrpprc UTSW 17 84771528 missense probably benign 0.25
R3848:Lrpprc UTSW 17 84770927 missense probably benign 0.01
R3973:Lrpprc UTSW 17 84770841 critical splice donor site probably null
R4111:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R4164:Lrpprc UTSW 17 84731189 missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 84740542 critical splice donor site probably null
R4531:Lrpprc UTSW 17 84712787 missense probably benign 0.01
R4832:Lrpprc UTSW 17 84707156 missense probably benign 0.24
R4947:Lrpprc UTSW 17 84771538 missense probably benign 0.02
R5134:Lrpprc UTSW 17 84751256 missense probably benign 0.00
R5333:Lrpprc UTSW 17 84790393 missense probably benign 0.01
R5950:Lrpprc UTSW 17 84740170 missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 84712822 missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 84767024 missense probably benign
R6253:Lrpprc UTSW 17 84740637 missense probably benign 0.00
R6488:Lrpprc UTSW 17 84751353 missense probably damaging 1.00
R6807:Lrpprc UTSW 17 84749103 missense possibly damaging 0.93
R6933:Lrpprc UTSW 17 84722703 missense probably benign 0.42
R6955:Lrpprc UTSW 17 84776989 missense probably damaging 0.98
R7448:Lrpprc UTSW 17 84772139 missense probably damaging 0.99
R7727:Lrpprc UTSW 17 84776947 missense probably benign 0.00
R8003:Lrpprc UTSW 17 84752317 missense probably benign 0.01
X0026:Lrpprc UTSW 17 84710662 missense probably benign 0.42
Z1088:Lrpprc UTSW 17 84731784 nonsense probably null
Z1088:Lrpprc UTSW 17 84770500 critical splice acceptor site probably null
Z1176:Lrpprc UTSW 17 84770431 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTCAGTAAGCCTGCAAGAC -3'
(R):5'- TAGTGGTCCCCATCCAAACC -3'

Sequencing Primer
(F):5'- GTAAGCCTGCAAGACCAAACGTC -3'
(R):5'- CCCCATCCAAACCAAAGTTTATTTTG -3'
Posted On2018-11-06