Mutagenetix > Incidental Mutations

Incidental Mutation 'R6911:Tcof1'

539055

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6911 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60813755-60848971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 60829051 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 702 (A702G)

Ref Sequence

ENSEMBL: ENSMUSP00000130454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163446
AA Change: A702G

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: A702G

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: A702G

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: A654G

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: A654G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,268,353	I459N	probably damaging	Het
4930407I10Rik	T	A	15: 82,063,867	M655K	probably benign	Het
Amt	G	T	9: 108,301,229		probably null	Het
Anapc7	A	T	5: 122,440,280	K443*	probably null	Het
Apcs	A	G	1: 172,894,185	V198A	probably benign	Het
Atp2a1	A	G	7: 126,456,836	V271A	probably damaging	Het
Cdh20	T	C	1: 104,984,686	I555T	possibly damaging	Het
Cgnl1	T	C	9: 71,656,215	E810G	possibly damaging	Het
Cntnap5c	A	G	17: 57,892,014	D101G	probably damaging	Het
Coq7	T	A	7: 118,510,162	H221L	unknown	Het
Depdc5	A	T	5: 32,924,192	Q566L	probably damaging	Het
Dync1i2	G	A	2: 71,247,102	V233I	probably benign	Het
Erp44	G	T	4: 48,204,268	H298N	probably benign	Het
Fam162a	A	G	16: 36,046,377		probably null	Het
Fancd2	A	G	6: 113,548,385	E274G	probably damaging	Het
Fkbp15	G	T	4: 62,340,290	Q147K	probably damaging	Het
Ganab	T	A	19: 8,907,788		probably null	Het
Gfm1	T	C	3: 67,451,303	V409A	possibly damaging	Het
Gm5346	A	T	8: 43,625,109	F693I	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid1	A	T	14: 34,820,228	M1L	probably benign	Het
Helz	C	T	11: 107,619,225	T558I	probably benign	Het
Htra4	A	G	8: 25,025,705	V439A	probably damaging	Het
Kctd17	A	G	15: 78,434,006	E95G	probably damaging	Het
Kif18b	T	C	11: 102,916,380	D43G	probably damaging	Het
Lrpprc	G	A	17: 84,756,283	S550L	possibly damaging	Het
Lrrfip1	T	A	1: 91,114,807	C311*	probably null	Het
Mcoln2	C	T	3: 146,192,256	T44I	probably damaging	Het
Med13l	A	G	5: 118,755,658	T2010A	possibly damaging	Het
Med23	C	T	10: 24,902,181	T803M	probably damaging	Het
Mfsd13a	T	C	19: 46,369,277	F290S	probably damaging	Het
Myh13	C	T	11: 67,354,927	Q1095*	probably null	Het
Nktr	C	A	9: 121,754,326	Y93*	probably null	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Ntrk2	A	T	13: 58,859,215	E210D	probably damaging	Het
Nup210	G	T	6: 91,030,130	A568E	probably damaging	Het
Olfr1111	T	A	2: 87,149,767	K298I	probably damaging	Het
Olfr1279	A	G	2: 111,306,273	T23A	probably benign	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr1393	A	G	11: 49,280,807	I220V	probably benign	Het
Pdlim5	T	C	3: 142,304,315	I289V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per1	C	T	11: 69,103,257	T443M	probably damaging	Het
Plxna1	A	G	6: 89,320,974	V1774A	probably damaging	Het
Poteg	A	G	8: 27,450,298	Y165C	probably damaging	Het
Prlr	A	G	15: 10,329,184	T582A	probably benign	Het
Psma5	A	G	3: 108,265,148	E60G	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr2	T	C	13: 11,827,559	N484S	possibly damaging	Het
Sec31a	A	G	5: 100,393,264	I328T	possibly damaging	Het
Slc12a2	G	T	18: 57,919,469	V787L	probably benign	Het
St14	C	T	9: 31,106,785	R177Q	probably benign	Het
Tom1l1	G	T	11: 90,644,161		probably null	Het
Ttf1	A	G	2: 29,064,851	R76G	probably benign	Het
Ube4a	C	T	9: 44,942,758	E581K	probably damaging	Het
Vmn2r114	A	G	17: 23,291,130	V792A	probably damaging	Het
Wdr11	T	C	7: 129,607,095	I430T	probably benign	Het
Xkr4	T	C	1: 3,671,321	K10E	possibly damaging	Het
Zfp451	T	C	1: 33,803,456		probably benign	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60814568	unclassified	probably benign
IGL01339:Tcof1	APN	18	60818095	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60831565	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60848743	unclassified	probably benign
IGL02513:Tcof1	APN	18	60831778	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60816048	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60833488	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60829061	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60835742	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60831938	missense	unknown
R0569:Tcof1	UTSW	18	60829035	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60816280	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60835850	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60818954	splice site	probably benign
R1528:Tcof1	UTSW	18	60814999	nonsense	probably null
R1643:Tcof1	UTSW	18	60816228	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60835773	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60831829	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60837901	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60832177	intron	probably benign
R2913:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60822837	missense	probably damaging	0.98
R3979:Tcof1	UTSW	18	60831533	missense	possibly damaging	0.71
R4049:Tcof1	UTSW	18	60832903	missense	possibly damaging	0.84
R4125:Tcof1	UTSW	18	60819601	missense	unknown
R5047:Tcof1	UTSW	18	60831914	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60818033	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60831556	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60819539	missense	unknown
R5965:Tcof1	UTSW	18	60833418	critical splice donor site	probably null
R6301:Tcof1	UTSW	18	60828825	missense	probably damaging	0.97
R6480:Tcof1	UTSW	18	60814780	intron	probably null
R6910:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60843296	missense	probably damaging	1.00
R7225:Tcof1	UTSW	18	60828448	missense	unknown
R7356:Tcof1	UTSW	18	60818094	missense	unknown
R7467:Tcof1	UTSW	18	60831905	missense	unknown
R7536:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7946:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60838762	missense	not run
RF001:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF005:Tcof1	UTSW	18	60833554	small insertion	probably benign
RF007:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF009:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF010:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF011:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF013:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF015:Tcof1	UTSW	18	60833584	small insertion	probably benign
RF016:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF022:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF024:Tcof1	UTSW	18	60835738	unclassified	probably benign
RF027:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF030:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF030:Tcof1	UTSW	18	60833574	small insertion	probably benign
RF030:Tcof1	UTSW	18	60835723	unclassified	probably benign
RF031:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF031:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF035:Tcof1	UTSW	18	60833553	small insertion	probably benign
RF036:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF036:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF038:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF040:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF040:Tcof1	UTSW	18	60833583	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833576	small insertion	probably benign
RF043:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF050:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF051:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF053:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF056:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833564	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF060:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF060:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF063:Tcof1	UTSW	18	60833573	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833574	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTTTTCCCTGAATCGAGAG -3'
(R):5'- CTGTTAGTTGGAAGGAGGAGCC -3'

Sequencing Primer
(F):5'- TTCCCTGAATCGAGAGGTGGC -3'
(R):5'- TTGGAAGGAGGAGCCAGCATC -3'

Posted On

2018-11-06