Incidental Mutation 'R6912:Dnah14'
ID539060
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181750183 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3022 (T3022S)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208001
AA Change: T3022S

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Aco2 G A 15: 81,895,396 V134I probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Bbs7 G T 3: 36,605,704 A194E probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah12 T C 14: 26,878,079 I3692T probably damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Ermp1 T A 19: 29,616,611 I720F probably benign Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kif16b A G 2: 142,700,099 probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCCTGGGAATGCTTC -3'
(R):5'- GAACTTGGCTGTCTCACTCTTG -3'

Sequencing Primer
(F):5'- GTTCTGACGGTCATGAAC -3'
(R):5'- TGATGAGGAGCCCTTTACCC -3'
Posted On2018-11-06