Incidental Mutation 'R6912:Dnah14'
ID 539060
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 045004-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6912 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181577748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 3022 (T3022S)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000208001
AA Change: T3022S

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,150,571 (GRCm39) T67I possibly damaging Het
Abca5 A T 11: 110,197,106 (GRCm39) M524K probably benign Het
Aco2 G A 15: 81,779,597 (GRCm39) V134I probably benign Het
Acsf2 C T 11: 94,461,206 (GRCm39) M323I probably benign Het
Acvr1 T C 2: 58,337,585 (GRCm39) D499G probably benign Het
Armc5 G A 7: 127,839,597 (GRCm39) C305Y probably damaging Het
Astl T C 2: 127,198,306 (GRCm39) I286T probably benign Het
Atp8a2 G A 14: 60,249,859 (GRCm39) S544L probably benign Het
Bbs7 G T 3: 36,659,853 (GRCm39) A194E probably benign Het
Brca2 A G 5: 150,465,207 (GRCm39) D1657G probably damaging Het
Cfap46 G A 7: 139,219,616 (GRCm39) S1283L probably benign Het
Creld2 T C 15: 88,704,200 (GRCm39) S64P probably damaging Het
Crtc1 T C 8: 70,850,961 (GRCm39) E217G probably damaging Het
Cyp2d26 C T 15: 82,675,320 (GRCm39) V345M probably benign Het
Cyp2j11 T C 4: 96,183,108 (GRCm39) M487V probably benign Het
Dnah12 T C 14: 26,600,036 (GRCm39) I3692T probably damaging Het
Dtnb A T 12: 3,698,221 (GRCm39) probably null Het
Erf T C 7: 24,944,003 (GRCm39) T443A possibly damaging Het
Ermp1 T A 19: 29,594,011 (GRCm39) I720F probably benign Het
Fam83b T A 9: 76,398,214 (GRCm39) E963V probably damaging Het
Fat1 T A 8: 45,504,060 (GRCm39) S4463T probably benign Het
Fbxw27 T A 9: 109,617,148 (GRCm39) K118* probably null Het
Fcgbp A T 7: 27,789,129 (GRCm39) Y565F probably benign Het
Garre1 A G 7: 33,945,093 (GRCm39) S384P probably benign Het
Gm128 A T 3: 95,147,740 (GRCm39) S185T probably benign Het
Gm6309 C T 5: 146,105,640 (GRCm39) E175K probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Gprin2 T C 14: 33,916,597 (GRCm39) Y391C probably damaging Het
Hexa T C 9: 59,447,221 (GRCm39) L72P probably damaging Het
Il31ra T A 13: 112,685,998 (GRCm39) D124V probably damaging Het
Kdm2a C T 19: 4,372,529 (GRCm39) A939T probably benign Het
Kif16b A G 2: 142,542,019 (GRCm39) probably benign Het
Kndc1 A T 7: 139,490,194 (GRCm39) D232V probably damaging Het
Lrrc37a T G 11: 103,348,369 (GRCm39) R2775S unknown Het
Luc7l3 C T 11: 94,200,462 (GRCm39) R52H probably damaging Het
Mapk15 A T 15: 75,865,747 (GRCm39) R13S probably damaging Het
Mdga2 G T 12: 66,552,889 (GRCm39) Q187K probably benign Het
Mfsd2b G A 12: 4,920,611 (GRCm39) Q69* probably null Het
Mlph A T 1: 90,873,342 (GRCm39) D551V probably damaging Het
Mup5 A T 4: 61,752,806 (GRCm39) F72L probably benign Het
Narf T C 11: 121,129,287 (GRCm39) S24P probably benign Het
Ncapg2 A G 12: 116,390,202 (GRCm39) I384V probably benign Het
Neo1 T C 9: 58,824,335 (GRCm39) T698A probably benign Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Nrros T C 16: 31,981,057 (GRCm39) R24G probably null Het
Or10ak9 T A 4: 118,726,335 (GRCm39) M119K probably damaging Het
Or6b1 T C 6: 42,815,736 (GRCm39) V307A probably benign Het
Pde9a T C 17: 31,685,386 (GRCm39) S347P possibly damaging Het
Pitpnm3 T C 11: 71,961,222 (GRCm39) D315G probably benign Het
Plaat5 A G 19: 7,616,830 (GRCm39) probably benign Het
Plekha6 C T 1: 133,200,273 (GRCm39) A284V probably benign Het
Plekhg2 A G 7: 28,059,684 (GRCm39) V1215A probably benign Het
Ppif C A 14: 25,698,711 (GRCm39) A144E probably damaging Het
Ppp1r10 T C 17: 36,240,453 (GRCm39) V581A possibly damaging Het
Prr12 A G 7: 44,698,269 (GRCm39) probably benign Het
Rfx6 T C 10: 51,599,949 (GRCm39) V565A probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Saxo2 A G 7: 82,284,402 (GRCm39) V152A possibly damaging Het
Sdk2 T C 11: 113,793,946 (GRCm39) D86G probably benign Het
Shroom3 A T 5: 93,090,876 (GRCm39) M1128L probably benign Het
Smok2a C A 17: 13,444,543 (GRCm39) T40K probably benign Het
Tatdn1 C T 15: 58,793,118 (GRCm39) probably null Het
Tbc1d2 C A 4: 46,649,712 (GRCm39) G108V probably damaging Het
Tbck T C 3: 132,392,703 (GRCm39) I48T possibly damaging Het
Tm7sf3 A G 6: 146,527,601 (GRCm39) F75S possibly damaging Het
Tmx4 T C 2: 134,440,719 (GRCm39) D245G probably benign Het
Trim68 A T 7: 102,333,675 (GRCm39) D2E probably damaging Het
Trps1 T A 15: 50,685,694 (GRCm39) Q157L possibly damaging Het
Ttc22 A G 4: 106,495,800 (GRCm39) T385A probably benign Het
Ubap2l A T 3: 89,946,155 (GRCm39) F150I possibly damaging Het
Ube2u C T 4: 100,389,352 (GRCm39) R105W probably damaging Het
Ubr4 G A 4: 139,185,545 (GRCm39) probably null Het
Unc5b A G 10: 60,666,871 (GRCm39) L25P probably benign Het
Usp38 A G 8: 81,719,958 (GRCm39) S424P probably damaging Het
Vmn1r222 T A 13: 23,416,374 (GRCm39) S280C probably benign Het
Vmn1r59 A T 7: 5,457,599 (GRCm39) F54I probably benign Het
Vmn2r-ps117 T A 17: 19,047,464 (GRCm39) C536S probably damaging Het
Zkscan2 A C 7: 123,099,196 (GRCm39) probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCCTGGGAATGCTTC -3'
(R):5'- GAACTTGGCTGTCTCACTCTTG -3'

Sequencing Primer
(F):5'- GTTCTGACGGTCATGAAC -3'
(R):5'- TGATGAGGAGCCCTTTACCC -3'
Posted On 2018-11-06