Incidental Mutation 'R6912:Bbs7'
ID539065
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36605704 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 194 (A194E)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000142333]
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: A194E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: A194E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
AA Change: A194E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: A194E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: A194E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: A194E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142333
SMART Domains Protein: ENSMUSP00000118961
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Aco2 G A 15: 81,895,396 V134I probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah12 T C 14: 26,878,079 I3692T probably damaging Het
Dnah14 A T 1: 181,750,183 T3022S possibly damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Ermp1 T A 19: 29,616,611 I720F probably benign Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kif16b A G 2: 142,700,099 probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36610223 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTATTCCCTACAGGTGAC -3'
(R):5'- TCAACACTCCTCTGTCTAGGG -3'

Sequencing Primer
(F):5'- TCCCTACAGGTGACTTCAAGATGAG -3'
(R):5'- CCTCTGTCTAGGGGTTCATTAAG -3'
Posted On2018-11-06