Mutagenetix > Incidental Mutations

Incidental Mutation 'R6912:Brca2'

539079

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6912 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150541742 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1657 (D1657G)

Ref Sequence

ENSEMBL: ENSMUSP00000144150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044620
AA Change: D1657G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: D1657G

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202003

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202313
AA Change: D1657G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: D1657G

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	G	A	7: 43,501,147	T67I	possibly damaging	Het
4931406P16Rik	A	G	7: 34,245,668	S384P	probably benign	Het
Abca5	A	T	11: 110,306,280	M524K	probably benign	Het
Aco2	G	A	15: 81,895,396	V134I	probably benign	Het
Acsf2	C	T	11: 94,570,380	M323I	probably benign	Het
Acvr1	T	C	2: 58,447,573	D499G	probably benign	Het
Armc5	G	A	7: 128,240,425	C305Y	probably damaging	Het
Astl	T	C	2: 127,356,386	I286T	probably benign	Het
Atp8a2	G	A	14: 60,012,410	S544L	probably benign	Het
Bbs7	G	T	3: 36,605,704	A194E	probably benign	Het
Cfap46	G	A	7: 139,639,700	S1283L	probably benign	Het
Creld2	T	C	15: 88,819,997	S64P	probably damaging	Het
Crtc1	T	C	8: 70,398,311	E217G	probably damaging	Het
Cyp2d26	C	T	15: 82,791,119	V345M	probably benign	Het
Cyp2j11	T	C	4: 96,294,871	M487V	probably benign	Het
Dnah12	T	C	14: 26,878,079	I3692T	probably damaging	Het
Dnah14	A	T	1: 181,750,183	T3022S	possibly damaging	Het
Dtnb	A	T	12: 3,648,221		probably null	Het
Erf	T	C	7: 25,244,578	T443A	possibly damaging	Het
Ermp1	T	A	19: 29,616,611	I720F	probably benign	Het
Fam83b	T	A	9: 76,490,932	E963V	probably damaging	Het
Fat1	T	A	8: 45,051,023	S4463T	probably benign	Het
Fbxw27	T	A	9: 109,788,080	K118*	probably null	Het
Fcgbp	A	T	7: 28,089,704	Y565F	probably benign	Het
Gm128	A	T	3: 95,240,429	S185T	probably benign	Het
Gm6309	C	T	5: 146,168,830	E175K	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gprin2	T	C	14: 34,194,640	Y391C	probably damaging	Het
Hexa	T	C	9: 59,539,938	L72P	probably damaging	Het
Hrasls5	A	G	19: 7,639,465		probably benign	Het
Il31ra	T	A	13: 112,549,464	D124V	probably damaging	Het
Kdm2a	C	T	19: 4,322,501	A939T	probably benign	Het
Kif16b	A	G	2: 142,700,099		probably benign	Het
Kndc1	A	T	7: 139,910,278	D232V	probably damaging	Het
Lrrc37a	T	G	11: 103,457,543	R2775S	unknown	Het
Luc7l3	C	T	11: 94,309,636	R52H	probably damaging	Het
Mapk15	A	T	15: 75,993,898	R13S	probably damaging	Het
Mdga2	G	T	12: 66,506,115	Q187K	probably benign	Het
Mfsd2b	G	A	12: 4,870,611	Q69*	probably null	Het
Mlph	A	T	1: 90,945,620	D551V	probably damaging	Het
Mup5	A	T	4: 61,834,569	F72L	probably benign	Het
Narf	T	C	11: 121,238,461	S24P	probably benign	Het
Ncapg2	A	G	12: 116,426,582	I384V	probably benign	Het
Neo1	T	C	9: 58,917,052	T698A	probably benign	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Nrros	T	C	16: 32,162,239	R24G	probably null	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr449	T	C	6: 42,838,802	V307A	probably benign	Het
Pde9a	T	C	17: 31,466,412	S347P	possibly damaging	Het
Pitpnm3	T	C	11: 72,070,396	D315G	probably benign	Het
Plekha6	C	T	1: 133,272,535	A284V	probably benign	Het
Plekhg2	A	G	7: 28,360,259	V1215A	probably benign	Het
Ppif	C	A	14: 25,698,287	A144E	probably damaging	Het
Ppp1r10	T	C	17: 35,929,561	V581A	possibly damaging	Het
Prr12	A	G	7: 45,048,845		probably benign	Het
Rfx6	T	C	10: 51,723,853	V565A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Saxo2	A	G	7: 82,635,194	V152A	possibly damaging	Het
Sdk2	T	C	11: 113,903,120	D86G	probably benign	Het
Shroom3	A	T	5: 92,943,017	M1128L	probably benign	Het
Smok2a	C	A	17: 13,225,656	T40K	probably benign	Het
Tatdn1	C	T	15: 58,921,269		probably null	Het
Tbc1d2	C	A	4: 46,649,712	G108V	probably damaging	Het
Tbck	T	C	3: 132,686,942	I48T	possibly damaging	Het
Tm7sf3	A	G	6: 146,626,103	F75S	possibly damaging	Het
Tmx4	T	C	2: 134,598,799	D245G	probably benign	Het
Trim68	A	T	7: 102,684,468	D2E	probably damaging	Het
Trps1	T	A	15: 50,822,298	Q157L	possibly damaging	Het
Ttc22	A	G	4: 106,638,603	T385A	probably benign	Het
Ubap2l	A	T	3: 90,038,848	F150I	possibly damaging	Het
Ube2u	C	T	4: 100,532,155	R105W	probably damaging	Het
Ubr4	G	A	4: 139,458,234		probably null	Het
Unc5b	A	G	10: 60,831,092	L25P	probably benign	Het
Usp38	A	G	8: 80,993,329	S424P	probably damaging	Het
Vmn1r222	T	A	13: 23,232,204	S280C	probably benign	Het
Vmn1r59	A	T	7: 5,454,600	F54I	probably benign	Het
Vmn2r-ps117	T	A	17: 18,827,202	C536S	probably damaging	Het
Zkscan2	A	C	7: 123,499,973		probably benign	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R7940:Brca2	UTSW	5	150538733	missense	probably benign
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGGAGACTGAAATGCTACCTC -3'
(R):5'- CACATTAGGGTCACTAAGGAGG -3'

Sequencing Primer
(F):5'- TGGTACCTCTTCCAAAGTACAAG -3'
(R):5'- TCACTAAGGAGGGTTGACACTTG -3'

Posted On

2018-11-06