Incidental Mutation 'R6912:Fam83b'
ID 539100
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 045004-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6912 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76398214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 963 (E963V)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: E963V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: E963V

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: E963V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: E963V

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,150,571 (GRCm39) T67I possibly damaging Het
Abca5 A T 11: 110,197,106 (GRCm39) M524K probably benign Het
Aco2 G A 15: 81,779,597 (GRCm39) V134I probably benign Het
Acsf2 C T 11: 94,461,206 (GRCm39) M323I probably benign Het
Acvr1 T C 2: 58,337,585 (GRCm39) D499G probably benign Het
Armc5 G A 7: 127,839,597 (GRCm39) C305Y probably damaging Het
Astl T C 2: 127,198,306 (GRCm39) I286T probably benign Het
Atp8a2 G A 14: 60,249,859 (GRCm39) S544L probably benign Het
Bbs7 G T 3: 36,659,853 (GRCm39) A194E probably benign Het
Brca2 A G 5: 150,465,207 (GRCm39) D1657G probably damaging Het
Cfap46 G A 7: 139,219,616 (GRCm39) S1283L probably benign Het
Creld2 T C 15: 88,704,200 (GRCm39) S64P probably damaging Het
Crtc1 T C 8: 70,850,961 (GRCm39) E217G probably damaging Het
Cyp2d26 C T 15: 82,675,320 (GRCm39) V345M probably benign Het
Cyp2j11 T C 4: 96,183,108 (GRCm39) M487V probably benign Het
Dnah12 T C 14: 26,600,036 (GRCm39) I3692T probably damaging Het
Dnah14 A T 1: 181,577,748 (GRCm39) T3022S possibly damaging Het
Dtnb A T 12: 3,698,221 (GRCm39) probably null Het
Erf T C 7: 24,944,003 (GRCm39) T443A possibly damaging Het
Ermp1 T A 19: 29,594,011 (GRCm39) I720F probably benign Het
Fat1 T A 8: 45,504,060 (GRCm39) S4463T probably benign Het
Fbxw27 T A 9: 109,617,148 (GRCm39) K118* probably null Het
Fcgbp A T 7: 27,789,129 (GRCm39) Y565F probably benign Het
Garre1 A G 7: 33,945,093 (GRCm39) S384P probably benign Het
Gm128 A T 3: 95,147,740 (GRCm39) S185T probably benign Het
Gm6309 C T 5: 146,105,640 (GRCm39) E175K probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Gprin2 T C 14: 33,916,597 (GRCm39) Y391C probably damaging Het
Hexa T C 9: 59,447,221 (GRCm39) L72P probably damaging Het
Il31ra T A 13: 112,685,998 (GRCm39) D124V probably damaging Het
Kdm2a C T 19: 4,372,529 (GRCm39) A939T probably benign Het
Kif16b A G 2: 142,542,019 (GRCm39) probably benign Het
Kndc1 A T 7: 139,490,194 (GRCm39) D232V probably damaging Het
Lrrc37a T G 11: 103,348,369 (GRCm39) R2775S unknown Het
Luc7l3 C T 11: 94,200,462 (GRCm39) R52H probably damaging Het
Mapk15 A T 15: 75,865,747 (GRCm39) R13S probably damaging Het
Mdga2 G T 12: 66,552,889 (GRCm39) Q187K probably benign Het
Mfsd2b G A 12: 4,920,611 (GRCm39) Q69* probably null Het
Mlph A T 1: 90,873,342 (GRCm39) D551V probably damaging Het
Mup5 A T 4: 61,752,806 (GRCm39) F72L probably benign Het
Narf T C 11: 121,129,287 (GRCm39) S24P probably benign Het
Ncapg2 A G 12: 116,390,202 (GRCm39) I384V probably benign Het
Neo1 T C 9: 58,824,335 (GRCm39) T698A probably benign Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Nrros T C 16: 31,981,057 (GRCm39) R24G probably null Het
Or10ak9 T A 4: 118,726,335 (GRCm39) M119K probably damaging Het
Or6b1 T C 6: 42,815,736 (GRCm39) V307A probably benign Het
Pde9a T C 17: 31,685,386 (GRCm39) S347P possibly damaging Het
Pitpnm3 T C 11: 71,961,222 (GRCm39) D315G probably benign Het
Plaat5 A G 19: 7,616,830 (GRCm39) probably benign Het
Plekha6 C T 1: 133,200,273 (GRCm39) A284V probably benign Het
Plekhg2 A G 7: 28,059,684 (GRCm39) V1215A probably benign Het
Ppif C A 14: 25,698,711 (GRCm39) A144E probably damaging Het
Ppp1r10 T C 17: 36,240,453 (GRCm39) V581A possibly damaging Het
Prr12 A G 7: 44,698,269 (GRCm39) probably benign Het
Rfx6 T C 10: 51,599,949 (GRCm39) V565A probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Saxo2 A G 7: 82,284,402 (GRCm39) V152A possibly damaging Het
Sdk2 T C 11: 113,793,946 (GRCm39) D86G probably benign Het
Shroom3 A T 5: 93,090,876 (GRCm39) M1128L probably benign Het
Smok2a C A 17: 13,444,543 (GRCm39) T40K probably benign Het
Tatdn1 C T 15: 58,793,118 (GRCm39) probably null Het
Tbc1d2 C A 4: 46,649,712 (GRCm39) G108V probably damaging Het
Tbck T C 3: 132,392,703 (GRCm39) I48T possibly damaging Het
Tm7sf3 A G 6: 146,527,601 (GRCm39) F75S possibly damaging Het
Tmx4 T C 2: 134,440,719 (GRCm39) D245G probably benign Het
Trim68 A T 7: 102,333,675 (GRCm39) D2E probably damaging Het
Trps1 T A 15: 50,685,694 (GRCm39) Q157L possibly damaging Het
Ttc22 A G 4: 106,495,800 (GRCm39) T385A probably benign Het
Ubap2l A T 3: 89,946,155 (GRCm39) F150I possibly damaging Het
Ube2u C T 4: 100,389,352 (GRCm39) R105W probably damaging Het
Ubr4 G A 4: 139,185,545 (GRCm39) probably null Het
Unc5b A G 10: 60,666,871 (GRCm39) L25P probably benign Het
Usp38 A G 8: 81,719,958 (GRCm39) S424P probably damaging Het
Vmn1r222 T A 13: 23,416,374 (GRCm39) S280C probably benign Het
Vmn1r59 A T 7: 5,457,599 (GRCm39) F54I probably benign Het
Vmn2r-ps117 T A 17: 19,047,464 (GRCm39) C536S probably damaging Het
Zkscan2 A C 7: 123,099,196 (GRCm39) probably benign Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATTGCCATTTGAAACGGAAG -3'
(R):5'- TCCGCCCCAAGATTTAATACCG -3'

Sequencing Primer
(F):5'- ATCCCCGGAACTTGTTTTC -3'
(R):5'- TTCCAAGGAGATCAGCTCACTCATG -3'
Posted On 2018-11-06