Incidental Mutation 'R6912:Mdga2'
ID 539113
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 045004-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6912 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 66552889 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 187 (Q187K)
Ref Sequence ENSEMBL: ENSMUSP00000152049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably benign
Transcript: ENSMUST00000037181
AA Change: Q915K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Q915K

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Q898K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222167
AA Change: Q846K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222623
AA Change: Q187K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222987
AA Change: Q187K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000223141
AA Change: Q839K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,150,571 (GRCm39) T67I possibly damaging Het
Abca5 A T 11: 110,197,106 (GRCm39) M524K probably benign Het
Aco2 G A 15: 81,779,597 (GRCm39) V134I probably benign Het
Acsf2 C T 11: 94,461,206 (GRCm39) M323I probably benign Het
Acvr1 T C 2: 58,337,585 (GRCm39) D499G probably benign Het
Armc5 G A 7: 127,839,597 (GRCm39) C305Y probably damaging Het
Astl T C 2: 127,198,306 (GRCm39) I286T probably benign Het
Atp8a2 G A 14: 60,249,859 (GRCm39) S544L probably benign Het
Bbs7 G T 3: 36,659,853 (GRCm39) A194E probably benign Het
Brca2 A G 5: 150,465,207 (GRCm39) D1657G probably damaging Het
Cfap46 G A 7: 139,219,616 (GRCm39) S1283L probably benign Het
Creld2 T C 15: 88,704,200 (GRCm39) S64P probably damaging Het
Crtc1 T C 8: 70,850,961 (GRCm39) E217G probably damaging Het
Cyp2d26 C T 15: 82,675,320 (GRCm39) V345M probably benign Het
Cyp2j11 T C 4: 96,183,108 (GRCm39) M487V probably benign Het
Dnah12 T C 14: 26,600,036 (GRCm39) I3692T probably damaging Het
Dnah14 A T 1: 181,577,748 (GRCm39) T3022S possibly damaging Het
Dtnb A T 12: 3,698,221 (GRCm39) probably null Het
Erf T C 7: 24,944,003 (GRCm39) T443A possibly damaging Het
Ermp1 T A 19: 29,594,011 (GRCm39) I720F probably benign Het
Fam83b T A 9: 76,398,214 (GRCm39) E963V probably damaging Het
Fat1 T A 8: 45,504,060 (GRCm39) S4463T probably benign Het
Fbxw27 T A 9: 109,617,148 (GRCm39) K118* probably null Het
Fcgbp A T 7: 27,789,129 (GRCm39) Y565F probably benign Het
Garre1 A G 7: 33,945,093 (GRCm39) S384P probably benign Het
Gm128 A T 3: 95,147,740 (GRCm39) S185T probably benign Het
Gm6309 C T 5: 146,105,640 (GRCm39) E175K probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Gprin2 T C 14: 33,916,597 (GRCm39) Y391C probably damaging Het
Hexa T C 9: 59,447,221 (GRCm39) L72P probably damaging Het
Il31ra T A 13: 112,685,998 (GRCm39) D124V probably damaging Het
Kdm2a C T 19: 4,372,529 (GRCm39) A939T probably benign Het
Kif16b A G 2: 142,542,019 (GRCm39) probably benign Het
Kndc1 A T 7: 139,490,194 (GRCm39) D232V probably damaging Het
Lrrc37a T G 11: 103,348,369 (GRCm39) R2775S unknown Het
Luc7l3 C T 11: 94,200,462 (GRCm39) R52H probably damaging Het
Mapk15 A T 15: 75,865,747 (GRCm39) R13S probably damaging Het
Mfsd2b G A 12: 4,920,611 (GRCm39) Q69* probably null Het
Mlph A T 1: 90,873,342 (GRCm39) D551V probably damaging Het
Mup5 A T 4: 61,752,806 (GRCm39) F72L probably benign Het
Narf T C 11: 121,129,287 (GRCm39) S24P probably benign Het
Ncapg2 A G 12: 116,390,202 (GRCm39) I384V probably benign Het
Neo1 T C 9: 58,824,335 (GRCm39) T698A probably benign Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Nrros T C 16: 31,981,057 (GRCm39) R24G probably null Het
Or10ak9 T A 4: 118,726,335 (GRCm39) M119K probably damaging Het
Or6b1 T C 6: 42,815,736 (GRCm39) V307A probably benign Het
Pde9a T C 17: 31,685,386 (GRCm39) S347P possibly damaging Het
Pitpnm3 T C 11: 71,961,222 (GRCm39) D315G probably benign Het
Plaat5 A G 19: 7,616,830 (GRCm39) probably benign Het
Plekha6 C T 1: 133,200,273 (GRCm39) A284V probably benign Het
Plekhg2 A G 7: 28,059,684 (GRCm39) V1215A probably benign Het
Ppif C A 14: 25,698,711 (GRCm39) A144E probably damaging Het
Ppp1r10 T C 17: 36,240,453 (GRCm39) V581A possibly damaging Het
Prr12 A G 7: 44,698,269 (GRCm39) probably benign Het
Rfx6 T C 10: 51,599,949 (GRCm39) V565A probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Saxo2 A G 7: 82,284,402 (GRCm39) V152A possibly damaging Het
Sdk2 T C 11: 113,793,946 (GRCm39) D86G probably benign Het
Shroom3 A T 5: 93,090,876 (GRCm39) M1128L probably benign Het
Smok2a C A 17: 13,444,543 (GRCm39) T40K probably benign Het
Tatdn1 C T 15: 58,793,118 (GRCm39) probably null Het
Tbc1d2 C A 4: 46,649,712 (GRCm39) G108V probably damaging Het
Tbck T C 3: 132,392,703 (GRCm39) I48T possibly damaging Het
Tm7sf3 A G 6: 146,527,601 (GRCm39) F75S possibly damaging Het
Tmx4 T C 2: 134,440,719 (GRCm39) D245G probably benign Het
Trim68 A T 7: 102,333,675 (GRCm39) D2E probably damaging Het
Trps1 T A 15: 50,685,694 (GRCm39) Q157L possibly damaging Het
Ttc22 A G 4: 106,495,800 (GRCm39) T385A probably benign Het
Ubap2l A T 3: 89,946,155 (GRCm39) F150I possibly damaging Het
Ube2u C T 4: 100,389,352 (GRCm39) R105W probably damaging Het
Ubr4 G A 4: 139,185,545 (GRCm39) probably null Het
Unc5b A G 10: 60,666,871 (GRCm39) L25P probably benign Het
Usp38 A G 8: 81,719,958 (GRCm39) S424P probably damaging Het
Vmn1r222 T A 13: 23,416,374 (GRCm39) S280C probably benign Het
Vmn1r59 A T 7: 5,457,599 (GRCm39) F54I probably benign Het
Vmn2r-ps117 T A 17: 19,047,464 (GRCm39) C536S probably damaging Het
Zkscan2 A C 7: 123,099,196 (GRCm39) probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGGATGCACAGGAGAGATTG -3'
(R):5'- AGTATGTGCTTCAATGCTTGC -3'

Sequencing Primer
(F):5'- GAGAGATTGTACTCAGAGTCTCC -3'
(R):5'- ATGTGCTTCAATGCTTGCTTCCC -3'
Posted On 2018-11-06