Incidental Mutation 'R6912:Dnah12'
ID539119
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26878079 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 3692 (I3692T)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: I3692T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: I3692T

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Meta Mutation Damage Score 0.2610 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Aco2 G A 15: 81,895,396 V134I probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Bbs7 G T 3: 36,605,704 A194E probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah14 A T 1: 181,750,183 T3022S possibly damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Ermp1 T A 19: 29,616,611 I720F probably benign Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kif16b A G 2: 142,700,099 probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26766115 missense probably benign 0.00
BB020:Dnah12 UTSW 14 26766115 missense probably benign 0.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 splice site probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 splice site probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26796219 missense probably benign 0.01
R7855:Dnah12 UTSW 14 26829329 missense probably benign 0.14
R7870:Dnah12 UTSW 14 26856529 missense probably benign 0.00
R7920:Dnah12 UTSW 14 26856542 missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26766115 missense probably benign 0.00
R7956:Dnah12 UTSW 14 26709272 missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26706881 missense probably benign
R8263:Dnah12 UTSW 14 26891464 missense noncoding transcript
R8287:Dnah12 UTSW 14 26812603 missense probably benign
R8336:Dnah12 UTSW 14 26711065 missense probably benign 0.01
R8362:Dnah12 UTSW 14 26854831 missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26885912 missense probably benign
R8458:Dnah12 UTSW 14 26826892 critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26853796 missense probably benign 0.02
R8551:Dnah12 UTSW 14 26774270 missense probably damaging 0.97
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26875215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGTTTACTCAAGAGCCTG -3'
(R):5'- CAGCAAGTTCAGAACACTGC -3'

Sequencing Primer
(F):5'- GAGCCTGAAATATTCGGATTACACG -3'
(R):5'- CAACTATAGTTACTAAGCACTTGGC -3'
Posted On2018-11-06