Incidental Mutation 'R6912:Atp8a2'
ID 539121
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene Name ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms Ib, wl, agil
MMRRC Submission 045004-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R6912 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59884980-60324363 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60249859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 544 (S544L)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
AlphaFold P98200
Predicted Effect probably benign
Transcript: ENSMUST00000080368
AA Change: S544L

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: S544L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,150,571 (GRCm39) T67I possibly damaging Het
Abca5 A T 11: 110,197,106 (GRCm39) M524K probably benign Het
Aco2 G A 15: 81,779,597 (GRCm39) V134I probably benign Het
Acsf2 C T 11: 94,461,206 (GRCm39) M323I probably benign Het
Acvr1 T C 2: 58,337,585 (GRCm39) D499G probably benign Het
Armc5 G A 7: 127,839,597 (GRCm39) C305Y probably damaging Het
Astl T C 2: 127,198,306 (GRCm39) I286T probably benign Het
Bbs7 G T 3: 36,659,853 (GRCm39) A194E probably benign Het
Brca2 A G 5: 150,465,207 (GRCm39) D1657G probably damaging Het
Cfap46 G A 7: 139,219,616 (GRCm39) S1283L probably benign Het
Creld2 T C 15: 88,704,200 (GRCm39) S64P probably damaging Het
Crtc1 T C 8: 70,850,961 (GRCm39) E217G probably damaging Het
Cyp2d26 C T 15: 82,675,320 (GRCm39) V345M probably benign Het
Cyp2j11 T C 4: 96,183,108 (GRCm39) M487V probably benign Het
Dnah12 T C 14: 26,600,036 (GRCm39) I3692T probably damaging Het
Dnah14 A T 1: 181,577,748 (GRCm39) T3022S possibly damaging Het
Dtnb A T 12: 3,698,221 (GRCm39) probably null Het
Erf T C 7: 24,944,003 (GRCm39) T443A possibly damaging Het
Ermp1 T A 19: 29,594,011 (GRCm39) I720F probably benign Het
Fam83b T A 9: 76,398,214 (GRCm39) E963V probably damaging Het
Fat1 T A 8: 45,504,060 (GRCm39) S4463T probably benign Het
Fbxw27 T A 9: 109,617,148 (GRCm39) K118* probably null Het
Fcgbp A T 7: 27,789,129 (GRCm39) Y565F probably benign Het
Garre1 A G 7: 33,945,093 (GRCm39) S384P probably benign Het
Gm128 A T 3: 95,147,740 (GRCm39) S185T probably benign Het
Gm6309 C T 5: 146,105,640 (GRCm39) E175K probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Gprin2 T C 14: 33,916,597 (GRCm39) Y391C probably damaging Het
Hexa T C 9: 59,447,221 (GRCm39) L72P probably damaging Het
Il31ra T A 13: 112,685,998 (GRCm39) D124V probably damaging Het
Kdm2a C T 19: 4,372,529 (GRCm39) A939T probably benign Het
Kif16b A G 2: 142,542,019 (GRCm39) probably benign Het
Kndc1 A T 7: 139,490,194 (GRCm39) D232V probably damaging Het
Lrrc37a T G 11: 103,348,369 (GRCm39) R2775S unknown Het
Luc7l3 C T 11: 94,200,462 (GRCm39) R52H probably damaging Het
Mapk15 A T 15: 75,865,747 (GRCm39) R13S probably damaging Het
Mdga2 G T 12: 66,552,889 (GRCm39) Q187K probably benign Het
Mfsd2b G A 12: 4,920,611 (GRCm39) Q69* probably null Het
Mlph A T 1: 90,873,342 (GRCm39) D551V probably damaging Het
Mup5 A T 4: 61,752,806 (GRCm39) F72L probably benign Het
Narf T C 11: 121,129,287 (GRCm39) S24P probably benign Het
Ncapg2 A G 12: 116,390,202 (GRCm39) I384V probably benign Het
Neo1 T C 9: 58,824,335 (GRCm39) T698A probably benign Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Nrros T C 16: 31,981,057 (GRCm39) R24G probably null Het
Or10ak9 T A 4: 118,726,335 (GRCm39) M119K probably damaging Het
Or6b1 T C 6: 42,815,736 (GRCm39) V307A probably benign Het
Pde9a T C 17: 31,685,386 (GRCm39) S347P possibly damaging Het
Pitpnm3 T C 11: 71,961,222 (GRCm39) D315G probably benign Het
Plaat5 A G 19: 7,616,830 (GRCm39) probably benign Het
Plekha6 C T 1: 133,200,273 (GRCm39) A284V probably benign Het
Plekhg2 A G 7: 28,059,684 (GRCm39) V1215A probably benign Het
Ppif C A 14: 25,698,711 (GRCm39) A144E probably damaging Het
Ppp1r10 T C 17: 36,240,453 (GRCm39) V581A possibly damaging Het
Prr12 A G 7: 44,698,269 (GRCm39) probably benign Het
Rfx6 T C 10: 51,599,949 (GRCm39) V565A probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Saxo2 A G 7: 82,284,402 (GRCm39) V152A possibly damaging Het
Sdk2 T C 11: 113,793,946 (GRCm39) D86G probably benign Het
Shroom3 A T 5: 93,090,876 (GRCm39) M1128L probably benign Het
Smok2a C A 17: 13,444,543 (GRCm39) T40K probably benign Het
Tatdn1 C T 15: 58,793,118 (GRCm39) probably null Het
Tbc1d2 C A 4: 46,649,712 (GRCm39) G108V probably damaging Het
Tbck T C 3: 132,392,703 (GRCm39) I48T possibly damaging Het
Tm7sf3 A G 6: 146,527,601 (GRCm39) F75S possibly damaging Het
Tmx4 T C 2: 134,440,719 (GRCm39) D245G probably benign Het
Trim68 A T 7: 102,333,675 (GRCm39) D2E probably damaging Het
Trps1 T A 15: 50,685,694 (GRCm39) Q157L possibly damaging Het
Ttc22 A G 4: 106,495,800 (GRCm39) T385A probably benign Het
Ubap2l A T 3: 89,946,155 (GRCm39) F150I possibly damaging Het
Ube2u C T 4: 100,389,352 (GRCm39) R105W probably damaging Het
Ubr4 G A 4: 139,185,545 (GRCm39) probably null Het
Unc5b A G 10: 60,666,871 (GRCm39) L25P probably benign Het
Usp38 A G 8: 81,719,958 (GRCm39) S424P probably damaging Het
Vmn1r222 T A 13: 23,416,374 (GRCm39) S280C probably benign Het
Vmn1r59 A T 7: 5,457,599 (GRCm39) F54I probably benign Het
Vmn2r-ps117 T A 17: 19,047,464 (GRCm39) C536S probably damaging Het
Zkscan2 A C 7: 123,099,196 (GRCm39) probably benign Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59,928,910 (GRCm39) missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60,265,512 (GRCm39) missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60,282,437 (GRCm39) missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60,253,317 (GRCm39) splice site probably benign
IGL01634:Atp8a2 APN 14 60,235,511 (GRCm39) missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59,928,982 (GRCm39) missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60,260,962 (GRCm39) missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60,263,609 (GRCm39) missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 60,094,497 (GRCm39) missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60,264,369 (GRCm39) splice site probably null
IGL02211:Atp8a2 APN 14 60,265,425 (GRCm39) missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60,254,248 (GRCm39) missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 60,235,451 (GRCm39) missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60,249,907 (GRCm39) splice site probably benign
IGL02795:Atp8a2 APN 14 60,271,191 (GRCm39) missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 60,039,701 (GRCm39) missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 60,162,571 (GRCm39) nonsense probably null
IGL03307:Atp8a2 APN 14 60,253,321 (GRCm39) critical splice donor site probably null
IGL03345:Atp8a2 APN 14 60,011,460 (GRCm39) missense probably benign
PIT4431001:Atp8a2 UTSW 14 59,892,075 (GRCm39) missense probably benign
R0334:Atp8a2 UTSW 14 59,928,961 (GRCm39) missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 60,097,661 (GRCm39) missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 60,011,193 (GRCm39) missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60,260,593 (GRCm39) missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60,247,330 (GRCm39) missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R0908:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R0991:Atp8a2 UTSW 14 60,031,378 (GRCm39) missense probably benign 0.33
R1025:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1190:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1387:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1426:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1442:Atp8a2 UTSW 14 60,097,772 (GRCm39) splice site probably benign
R1472:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1538:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1573:Atp8a2 UTSW 14 60,097,655 (GRCm39) missense probably benign 0.00
R1620:Atp8a2 UTSW 14 60,028,632 (GRCm39) missense probably benign
R1661:Atp8a2 UTSW 14 60,097,635 (GRCm39) missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 60,028,689 (GRCm39) missense probably benign 0.00
R1749:Atp8a2 UTSW 14 60,097,623 (GRCm39) nonsense probably null
R1796:Atp8a2 UTSW 14 60,258,207 (GRCm39) critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60,324,073 (GRCm39) missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60,243,815 (GRCm39) missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1936:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1937:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R2416:Atp8a2 UTSW 14 60,162,457 (GRCm39) missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 60,097,641 (GRCm39) missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59,928,914 (GRCm39) frame shift probably null
R3621:Atp8a2 UTSW 14 60,263,587 (GRCm39) splice site probably null
R3768:Atp8a2 UTSW 14 60,281,785 (GRCm39) missense probably benign 0.19
R3784:Atp8a2 UTSW 14 60,011,415 (GRCm39) missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60,263,589 (GRCm39) critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60,265,434 (GRCm39) missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59,892,078 (GRCm39) missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59,928,916 (GRCm39) missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60,245,918 (GRCm39) nonsense probably null
R5059:Atp8a2 UTSW 14 59,928,986 (GRCm39) missense probably benign 0.00
R5529:Atp8a2 UTSW 14 60,031,314 (GRCm39) critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60,258,242 (GRCm39) missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60,281,775 (GRCm39) missense probably benign
R6295:Atp8a2 UTSW 14 60,249,848 (GRCm39) nonsense probably null
R6393:Atp8a2 UTSW 14 60,011,204 (GRCm39) nonsense probably null
R6454:Atp8a2 UTSW 14 60,245,948 (GRCm39) splice site probably null
R6651:Atp8a2 UTSW 14 60,011,470 (GRCm39) missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60,245,857 (GRCm39) missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60,284,171 (GRCm39) missense probably damaging 1.00
R7032:Atp8a2 UTSW 14 60,255,289 (GRCm39) splice site probably null
R7243:Atp8a2 UTSW 14 59,885,291 (GRCm39) missense probably benign
R7352:Atp8a2 UTSW 14 60,028,653 (GRCm39) missense probably benign
R7355:Atp8a2 UTSW 14 60,282,453 (GRCm39) missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59,892,043 (GRCm39) missense probably benign 0.00
R7451:Atp8a2 UTSW 14 60,028,630 (GRCm39) missense probably null 0.00
R7483:Atp8a2 UTSW 14 60,245,824 (GRCm39) missense probably benign 0.00
R7516:Atp8a2 UTSW 14 60,094,516 (GRCm39) missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 60,011,202 (GRCm39) missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60,263,657 (GRCm39) missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60,283,493 (GRCm39) missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59,885,366 (GRCm39) nonsense probably null
R8516:Atp8a2 UTSW 14 59,928,921 (GRCm39) missense probably benign 0.00
R8552:Atp8a2 UTSW 14 60,011,431 (GRCm39) missense probably benign 0.00
R8852:Atp8a2 UTSW 14 60,162,545 (GRCm39) missense probably damaging 1.00
R9367:Atp8a2 UTSW 14 60,249,827 (GRCm39) critical splice donor site probably null
R9469:Atp8a2 UTSW 14 60,028,668 (GRCm39) missense probably benign 0.32
R9691:Atp8a2 UTSW 14 60,245,829 (GRCm39) missense probably damaging 0.96
R9709:Atp8a2 UTSW 14 60,271,187 (GRCm39) missense probably damaging 0.98
Z1088:Atp8a2 UTSW 14 60,265,419 (GRCm39) missense probably benign
Z1177:Atp8a2 UTSW 14 60,243,779 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACCTGTGTTCCTAGTGGCTTG -3'
(R):5'- AGGCATCTGTCCATTTGGTAG -3'

Sequencing Primer
(F):5'- CTAGTGGCTTGCTAGGACTGTC -3'
(R):5'- GATGGGTAAACTCTACTGTTGAAGC -3'
Posted On 2018-11-06