Incidental Mutation 'R6912:Aco2'
ID539125
Institutional Source Beutler Lab
Gene Symbol Aco2
Ensembl Gene ENSMUSG00000022477
Gene Nameaconitase 2, mitochondrial
SynonymsAco-2, Aco3, D10Wsu183e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81872309-81915133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81895396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 134 (V134I)
Ref Sequence ENSEMBL: ENSMUSP00000023116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023116] [ENSMUST00000229068] [ENSMUST00000231091]
Predicted Effect probably benign
Transcript: ENSMUST00000023116
AA Change: V134I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477
AA Change: V134I

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229068
Predicted Effect probably benign
Transcript: ENSMUST00000231091
Meta Mutation Damage Score 0.1009 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Bbs7 G T 3: 36,605,704 A194E probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah12 T C 14: 26,878,079 I3692T probably damaging Het
Dnah14 A T 1: 181,750,183 T3022S possibly damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Ermp1 T A 19: 29,616,611 I720F probably benign Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kif16b A G 2: 142,700,099 probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Aco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Aco2 APN 15 81913714 missense possibly damaging 0.88
IGL02450:Aco2 APN 15 81914762 makesense probably null
IGL03408:Aco2 APN 15 81899223 critical splice donor site probably null
ANU22:Aco2 UTSW 15 81913714 missense possibly damaging 0.88
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0254:Aco2 UTSW 15 81889356 missense probably damaging 0.99
R0408:Aco2 UTSW 15 81913118 unclassified probably null
R0535:Aco2 UTSW 15 81913217 missense possibly damaging 0.76
R0839:Aco2 UTSW 15 81907535 splice site probably null
R1199:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1201:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1320:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1321:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1322:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R2082:Aco2 UTSW 15 81913695 missense possibly damaging 0.83
R2275:Aco2 UTSW 15 81895264 missense probably benign 0.37
R2297:Aco2 UTSW 15 81903908 missense probably damaging 1.00
R4414:Aco2 UTSW 15 81889383 splice site probably null
R4497:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4498:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4708:Aco2 UTSW 15 81909916 critical splice donor site probably null
R5556:Aco2 UTSW 15 81889319 missense probably damaging 1.00
R5568:Aco2 UTSW 15 81903586 missense probably damaging 0.99
R6103:Aco2 UTSW 15 81913251 missense probably benign 0.00
R7319:Aco2 UTSW 15 81903619 missense probably damaging 1.00
R7552:Aco2 UTSW 15 81903941 missense probably damaging 1.00
R7585:Aco2 UTSW 15 81872484 unclassified probably benign
Z1177:Aco2 UTSW 15 81895310 missense probably damaging 1.00
Z1177:Aco2 UTSW 15 81895312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATGGACACCTGGATGACCC -3'
(R):5'- ACTAGGGGCAATCTGTTAGTTTTC -3'

Sequencing Primer
(F):5'- CAGCCAACCAGGAGATCGAG -3'
(R):5'- GGTAGAACACTTGCTTGTCAC -3'
Posted On2018-11-06