Incidental Mutation 'R6912:Ermp1'
ID539135
Institutional Source Beutler Lab
Gene Symbol Ermp1
Ensembl Gene ENSMUSG00000046324
Gene Nameendoplasmic reticulum metallopeptidase 1
SynonymsD19Ertd410e, D19Wsu12e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29608214-29648415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29616611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 720 (I720F)
Ref Sequence ENSEMBL: ENSMUSP00000124881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054083] [ENSMUST00000159692] [ENSMUST00000162534]
Predicted Effect probably benign
Transcript: ENSMUST00000054083
SMART Domains Protein: ENSMUSP00000057069
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
SCOP:d1amp__ 31 159 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159692
AA Change: I720F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324
AA Change: I720F

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162534
SMART Domains Protein: ENSMUSP00000124992
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
Pfam:Peptidase_M28 5 176 2.4e-40 PFAM
Pfam:Peptidase_M20 8 168 1.3e-8 PFAM
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
transmembrane domain 294 316 N/A INTRINSIC
transmembrane domain 329 351 N/A INTRINSIC
transmembrane domain 356 375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including double outlet right ventricle, aortic arch anomalies and vascular ring, as well as anopthalmia, renal dysplasia, and craniofacial anomalies including short snout, cleft palate and cleft lip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Aco2 G A 15: 81,895,396 V134I probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Bbs7 G T 3: 36,605,704 A194E probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah12 T C 14: 26,878,079 I3692T probably damaging Het
Dnah14 A T 1: 181,750,183 T3022S possibly damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kif16b A G 2: 142,700,099 probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Ermp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Ermp1 APN 19 29639939 missense probably damaging 1.00
IGL01696:Ermp1 APN 19 29646138 missense possibly damaging 0.65
IGL01759:Ermp1 APN 19 29615836 missense probably benign 0.03
IGL01891:Ermp1 APN 19 29616602 missense probably benign 0.16
IGL02008:Ermp1 APN 19 29612920 missense probably damaging 1.00
IGL02034:Ermp1 APN 19 29645959 splice site probably benign
IGL02655:Ermp1 APN 19 29646210 nonsense probably null
IGL03074:Ermp1 APN 19 29612535 missense probably damaging 1.00
PIT4366001:Ermp1 UTSW 19 29628789 missense probably benign 0.24
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0361:Ermp1 UTSW 19 29631406 missense probably damaging 1.00
R0684:Ermp1 UTSW 19 29632541 splice site probably benign
R0711:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R1167:Ermp1 UTSW 19 29628679 missense possibly damaging 0.53
R1869:Ermp1 UTSW 19 29646015 missense possibly damaging 0.66
R1884:Ermp1 UTSW 19 29616679 missense probably benign 0.00
R2094:Ermp1 UTSW 19 29639928 missense probably benign 0.09
R2135:Ermp1 UTSW 19 29646065 missense possibly damaging 0.81
R2153:Ermp1 UTSW 19 29637398 critical splice acceptor site probably null
R2290:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R4176:Ermp1 UTSW 19 29645965 critical splice donor site probably null
R4363:Ermp1 UTSW 19 29612876 missense probably damaging 1.00
R4579:Ermp1 UTSW 19 29616651 missense probably damaging 0.98
R4761:Ermp1 UTSW 19 29646256 missense probably benign 0.03
R5801:Ermp1 UTSW 19 29612828 missense probably damaging 1.00
R5931:Ermp1 UTSW 19 29615729 missense probably benign 0.01
R6129:Ermp1 UTSW 19 29623209 missense possibly damaging 0.95
R6556:Ermp1 UTSW 19 29612921 missense possibly damaging 0.91
R6563:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R6598:Ermp1 UTSW 19 29632502 missense possibly damaging 0.82
R6647:Ermp1 UTSW 19 29626935 missense probably benign 0.27
R6850:Ermp1 UTSW 19 29616641 missense probably damaging 1.00
R7341:Ermp1 UTSW 19 29646254 missense probably benign 0.20
R7391:Ermp1 UTSW 19 29627068 critical splice acceptor site probably null
R7391:Ermp1 UTSW 19 29627069 critical splice acceptor site probably null
R7463:Ermp1 UTSW 19 29646262 nonsense probably null
R7471:Ermp1 UTSW 19 29612654 missense probably benign 0.06
R7831:Ermp1 UTSW 19 29617967 missense probably benign 0.00
R7836:Ermp1 UTSW 19 29632388 splice site probably null
R7923:Ermp1 UTSW 19 29628658 missense probably benign 0.01
R8113:Ermp1 UTSW 19 29615796 missense probably benign 0.00
R8116:Ermp1 UTSW 19 29623796 missense probably damaging 0.98
R8692:Ermp1 UTSW 19 29616693 missense probably benign 0.04
Z1088:Ermp1 UTSW 19 29612925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGCTTGACTGAGTTAAGG -3'
(R):5'- AGTGCCTGCTTGCTCCAG -3'

Sequencing Primer
(F):5'- GGTTAAATTTCACTGAATCCTGACAG -3'
(R):5'- GGATTTGAACTCAGGACCTTCAG -3'
Posted On2018-11-06