Incidental Mutation 'R6913:Mylk2'
ID539147
Institutional Source Beutler Lab
Gene Symbol Mylk2
Ensembl Gene ENSMUSG00000027470
Gene Namemyosin, light polypeptide kinase 2, skeletal muscle
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152911352-152923068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152913690 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 258 (G258E)
Ref Sequence ENSEMBL: ENSMUSP00000028970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028970]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028970
AA Change: G258E

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470
AA Change: G258E

DomainStartEndE-ValueType
low complexity region 90 122 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 278 285 N/A INTRINSIC
S_TKc 302 557 6.08e-87 SMART
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Mylk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Mylk2 APN 2 152915214 missense probably benign 0.20
IGL02097:Mylk2 APN 2 152915136 missense probably damaging 0.98
IGL02158:Mylk2 APN 2 152919157 missense probably damaging 1.00
IGL02189:Mylk2 APN 2 152915154 missense probably damaging 1.00
IGL02243:Mylk2 APN 2 152920553 missense probably damaging 1.00
IGL02716:Mylk2 APN 2 152922153 makesense probably null
IGL02946:Mylk2 APN 2 152919210 nonsense probably null
IGL03105:Mylk2 APN 2 152917359 missense possibly damaging 0.94
R1184:Mylk2 UTSW 2 152913741 critical splice donor site probably null
R1443:Mylk2 UTSW 2 152919416 missense probably damaging 1.00
R1957:Mylk2 UTSW 2 152917607 missense possibly damaging 0.86
R2496:Mylk2 UTSW 2 152913668 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R3081:Mylk2 UTSW 2 152919354 missense probably benign 0.31
R4510:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4511:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4600:Mylk2 UTSW 2 152917556 missense probably damaging 1.00
R4633:Mylk2 UTSW 2 152917415 missense probably benign 0.00
R4890:Mylk2 UTSW 2 152920354 missense possibly damaging 0.88
R5267:Mylk2 UTSW 2 152913549 missense probably benign
R5430:Mylk2 UTSW 2 152917548 missense probably damaging 1.00
R5447:Mylk2 UTSW 2 152912510 missense probably damaging 0.96
R6167:Mylk2 UTSW 2 152915753 splice site probably null
R6327:Mylk2 UTSW 2 152913693 missense possibly damaging 0.77
R6391:Mylk2 UTSW 2 152917395 missense probably damaging 1.00
R7066:Mylk2 UTSW 2 152911668 intron probably null
R7092:Mylk2 UTSW 2 152915190 missense probably benign 0.21
R7403:Mylk2 UTSW 2 152917341 missense probably damaging 1.00
R7442:Mylk2 UTSW 2 152911426 start gained probably benign
R7443:Mylk2 UTSW 2 152911426 start gained probably benign
R7453:Mylk2 UTSW 2 152912433 missense probably damaging 1.00
R7477:Mylk2 UTSW 2 152920341 missense probably damaging 1.00
R7529:Mylk2 UTSW 2 152915704 missense probably damaging 1.00
R8029:Mylk2 UTSW 2 152920299 missense probably damaging 1.00
Z1177:Mylk2 UTSW 2 152920330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTACAGGGGTGTCTGTGACC -3'
(R):5'- GAAATACTACCCGGTGTCCTG -3'

Sequencing Primer
(F):5'- GTGTCTGTGACCCCTGACC -3'
(R):5'- CTGTGACATTTGCACCAGGGAG -3'
Posted On2018-11-06