Incidental Mutation 'R6913:Mamstr'
ID539166
Institutional Source Beutler Lab
Gene Symbol Mamstr
Ensembl Gene ENSMUSG00000042918
Gene NameMEF2 activating motif and SAP domain containing transcriptional regulator
Synonyms2810022D01Rik, MASTR, 5430432N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45639977-45646521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45643238 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 141 (M141L)
Ref Sequence ENSEMBL: ENSMUSP00000114686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057927] [ENSMUST00000148532] [ENSMUST00000210169]
Predicted Effect probably benign
Transcript: ENSMUST00000057927
SMART Domains Protein: ENSMUSP00000062429
Gene: ENSMUSG00000044562

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 59 67 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
RA 141 253 6.94e-8 SMART
low complexity region 284 308 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
SCOP:d1gxca_ 391 484 1e-2 SMART
low complexity region 498 509 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
DIL 768 877 4.14e-44 SMART
low complexity region 928 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148532
AA Change: M141L

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114686
Gene: ENSMUSG00000042918
AA Change: M141L

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
SAP 165 199 1.3e-7 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 255 297 N/A INTRINSIC
low complexity region 320 336 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 385 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210169
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Mamstr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mamstr APN 7 45644285 missense probably benign 0.15
R0046:Mamstr UTSW 7 45641770 unclassified probably benign
R0046:Mamstr UTSW 7 45641770 unclassified probably benign
R1836:Mamstr UTSW 7 45644963 missense probably damaging 1.00
R2357:Mamstr UTSW 7 45642330 missense probably damaging 0.98
R3815:Mamstr UTSW 7 45644532 missense probably damaging 0.98
R4678:Mamstr UTSW 7 45644692 splice site probably benign
R4679:Mamstr UTSW 7 45644692 splice site probably benign
R4801:Mamstr UTSW 7 45642418 missense possibly damaging 0.69
R4802:Mamstr UTSW 7 45642418 missense possibly damaging 0.69
R4883:Mamstr UTSW 7 45644414 missense probably benign 0.24
R8045:Mamstr UTSW 7 45644403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGAGACACCCCATTTTCC -3'
(R):5'- AGAGAAGGTGCTGAGCTCTG -3'

Sequencing Primer
(F):5'- AGAGACACCCCATTTTCCTATCTTC -3'
(R):5'- ATCCAGACCGACTTTCCTAGGG -3'
Posted On2018-11-06